Incidental Mutation 'R0734:Crb1'
ID68123
Institutional Source Beutler Lab
Gene Symbol Crb1
Ensembl Gene ENSMUSG00000063681
Gene Namecrumbs family member 1, photoreceptor morphogenesis associated
Synonyms7530426H14Rik, A930008G09Rik
MMRRC Submission 038915-MU
Accession Numbers

Ncbi RefSeq: NM_133239.2; MGI: 2136343

Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R0734 (G1)
Quality Score84
Status Validated
Chromosome1
Chromosomal Location139197056-139377100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139337084 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 199 (V199M)
Ref Sequence ENSEMBL: ENSMUSP00000142702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059825] [ENSMUST00000196402] [ENSMUST00000198445]
Predicted Effect probably benign
Transcript: ENSMUST00000059825
AA Change: V199M

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000060769
Gene: ENSMUSG00000063681
AA Change: V199M

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 336 8.12e-6 SMART
EGF 341 394 2.6e-4 SMART
EGF_CA 396 438 2.54e-7 SMART
EGF 443 480 1.47e-3 SMART
LamG 505 650 1.75e-9 SMART
EGF 674 707 6.5e-5 SMART
LamG 734 859 1.05e-7 SMART
EGF 889 922 1.19e-3 SMART
LamG 971 1104 6.85e-12 SMART
EGF 1141 1174 7.07e-6 SMART
EGF_CA 1176 1211 3.01e-9 SMART
EGF 1216 1249 3.57e-2 SMART
EGF 1257 1294 6.92e0 SMART
EGF_CA 1296 1332 4.19e-8 SMART
transmembrane domain 1346 1368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196402
AA Change: V199M

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142702
Gene: ENSMUSG00000063681
AA Change: V199M

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 336 8.12e-6 SMART
EGF 341 394 2.6e-4 SMART
EGF_CA 396 438 2.54e-7 SMART
EGF 443 480 1.47e-3 SMART
LamG 505 650 1.75e-9 SMART
EGF 674 707 6.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198445
AA Change: V199M

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142552
Gene: ENSMUSG00000063681
AA Change: V199M

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 333 1.63e1 SMART
EGF_CA 335 377 2.54e-7 SMART
EGF 382 419 1.47e-3 SMART
LamG 444 589 1.75e-9 SMART
EGF 613 646 6.5e-5 SMART
LamG 673 798 1.05e-7 SMART
EGF 828 861 1.19e-3 SMART
LamG 910 1043 6.85e-12 SMART
EGF 1080 1113 7.07e-6 SMART
EGF_CA 1115 1150 3.01e-9 SMART
EGF 1155 1188 3.57e-2 SMART
EGF 1196 1233 6.92e0 SMART
EGF_CA 1235 1271 4.19e-8 SMART
low complexity region 1282 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 99% (80/81)
MGI Phenotype Strain: 3052072; 2676366
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar to the Drosophila crumbs protein and localizes to the inner segment of mammalian photoreceptors. In Drosophila crumbs localizes to the stalk of the fly photoreceptor and may be a component of the molecular scaffold that controls proper development of polarity in the eye. Mutations in this gene are associated with a severe form of retinitis pigmentosa, RP12, and with Leber congenital amaurosis. Alternate splicing results in multiple transcript variants, some protein coding and some non-protein coding.[provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygotes for a null allele show focal retinal lesions, loss of adherens junctions between photoreceptors and Muller glia cells, and light-accelerated retinal degeneration. Homozygotes for a spontaneous allele show background-sensitive retinal spotting, photoreceptor dysplasia and degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Spontaneous(1)
 

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,850,334 S530T probably benign Het
Acer2 G T 4: 86,917,559 K223N probably benign Het
Adam19 T G 11: 46,127,403 C431G probably damaging Het
Adamts16 T G 13: 70,738,481 probably benign Het
Aox2 A T 1: 58,305,341 E531V probably benign Het
Apaf1 A T 10: 91,037,021 N720K probably benign Het
Atrnl1 T A 19: 57,654,861 W394R probably damaging Het
Bcl6 T C 16: 23,968,139 E634G probably damaging Het
Cfap65 T A 1: 74,918,887 Y954F probably damaging Het
Cobl A G 11: 12,375,971 V168A probably damaging Het
Cped1 C T 6: 22,085,041 P210S probably damaging Het
Cyp2j6 A T 4: 96,523,844 probably benign Het
Dhrs3 C G 4: 144,927,176 S289W probably damaging Het
Dido1 T G 2: 180,660,042 Q2023P probably benign Het
Dlg4 G A 11: 70,042,705 G550R probably damaging Het
Dnah12 C A 14: 26,800,013 H1928N probably benign Het
Dthd1 A C 5: 62,839,410 probably benign Het
Erg C A 16: 95,370,025 G269C possibly damaging Het
Erich6 G A 3: 58,629,388 probably benign Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fancc T C 13: 63,331,842 R300G probably damaging Het
Fcer1g T A 1: 171,231,179 K47* probably null Het
Flt4 A G 11: 49,626,717 T289A possibly damaging Het
Gcnt2 T A 13: 40,860,521 F56Y probably benign Het
Gpatch8 G T 11: 102,481,400 S437R unknown Het
Grin2a T A 16: 9,579,611 I871F possibly damaging Het
Hsd17b4 T C 18: 50,170,777 V439A possibly damaging Het
Hykk A T 9: 54,946,432 K346M possibly damaging Het
Ifi208 T C 1: 173,683,335 L352S probably damaging Het
Ikzf1 T C 11: 11,758,195 V110A probably damaging Het
Irak3 A T 10: 120,145,637 probably benign Het
Lamp5 T A 2: 136,059,030 V50E probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch3 C T 16: 32,997,483 R570* probably null Het
Map1lc3a T C 2: 155,276,976 V20A possibly damaging Het
Map3k14 C A 11: 103,227,000 K655N probably benign Het
Mark2 A G 19: 7,285,981 probably benign Het
Mbtd1 G A 11: 93,923,146 G205D probably damaging Het
Med13 T C 11: 86,301,237 T861A probably benign Het
Meltf T A 16: 31,881,958 Y99N probably damaging Het
Mex3d G A 10: 80,381,532 T617I possibly damaging Het
Muc13 G A 16: 33,803,082 V249I probably damaging Het
Myo18a C A 11: 77,847,404 P1688Q probably damaging Het
Naaladl1 A T 19: 6,112,874 probably null Het
Ncoa3 T A 2: 166,069,191 probably benign Het
Nf2 T C 11: 4,820,409 T67A probably benign Het
Nin A G 12: 70,030,113 V1056A probably benign Het
Olfr1426 T A 19: 12,088,119 R224S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr59 A T 11: 74,288,946 Q100L probably damaging Het
P3h1 T C 4: 119,238,688 L331P probably damaging Het
Pabpc4l T C 3: 46,446,973 K79E possibly damaging Het
Pam T A 1: 97,864,362 R445* probably null Het
Pcdhb6 T C 18: 37,335,334 I436T probably damaging Het
Piezo2 A G 18: 63,041,723 Y1987H probably damaging Het
Plch2 G A 4: 154,996,283 T477I probably damaging Het
Postn G A 3: 54,362,715 G72R probably damaging Het
Proca1 G A 11: 78,201,802 probably benign Het
Psip1 T A 4: 83,463,588 probably benign Het
Ptprd G A 4: 76,140,597 P153L probably damaging Het
Rgl1 T C 1: 152,554,300 D242G probably damaging Het
Ric1 T A 19: 29,594,818 I671K possibly damaging Het
Rxrg T A 1: 167,627,444 C199S probably damaging Het
Sec24c A C 14: 20,693,745 D1006A probably damaging Het
Sec63 A G 10: 42,796,208 T173A probably benign Het
Sfxn5 T C 6: 85,267,865 probably benign Het
Spam1 A G 6: 24,796,949 I300V probably benign Het
Spem1 A G 11: 69,821,271 L189P probably damaging Het
Sptbn2 A T 19: 4,748,123 R1959* probably null Het
Timeless C T 10: 128,250,060 R935W probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim24 T C 6: 37,919,465 Y286H possibly damaging Het
Ttyh2 A G 11: 114,710,193 probably benign Het
Zbtb21 C T 16: 97,952,627 C180Y probably damaging Het
Zfp746 T C 6: 48,064,899 T298A probably damaging Het
Other mutations in Crb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Crb1 APN 1 139323245 missense probably benign 0.16
IGL01591:Crb1 APN 1 139237339 missense probably damaging 1.00
IGL01644:Crb1 APN 1 139237630 nonsense probably null
IGL01769:Crb1 APN 1 139337068 missense probably damaging 1.00
IGL02172:Crb1 APN 1 139237227 missense probably damaging 1.00
IGL02294:Crb1 APN 1 139234782 missense possibly damaging 0.89
IGL02382:Crb1 APN 1 139237614 missense probably damaging 0.99
IGL02411:Crb1 APN 1 139248475 missense probably damaging 1.00
IGL03070:Crb1 APN 1 139241258 missense possibly damaging 0.79
IGL02984:Crb1 UTSW 1 139237086 frame shift probably null
IGL02988:Crb1 UTSW 1 139237086 frame shift probably null
IGL02991:Crb1 UTSW 1 139237084 frame shift probably null
IGL02991:Crb1 UTSW 1 139237086 frame shift probably null
IGL03014:Crb1 UTSW 1 139237086 frame shift probably null
IGL03050:Crb1 UTSW 1 139237086 frame shift probably null
IGL03054:Crb1 UTSW 1 139237086 frame shift probably null
IGL03055:Crb1 UTSW 1 139237086 frame shift probably null
IGL03097:Crb1 UTSW 1 139237086 frame shift probably null
IGL03098:Crb1 UTSW 1 139237086 frame shift probably null
IGL03134:Crb1 UTSW 1 139237086 frame shift probably null
IGL03138:Crb1 UTSW 1 139237086 frame shift probably null
IGL03147:Crb1 UTSW 1 139237086 frame shift probably null
P0017:Crb1 UTSW 1 139248940 missense possibly damaging 0.64
R0276:Crb1 UTSW 1 139323335 missense possibly damaging 0.85
R0325:Crb1 UTSW 1 139241166 missense probably damaging 1.00
R0401:Crb1 UTSW 1 139198791 splice site probably benign
R0479:Crb1 UTSW 1 139198614 missense probably damaging 0.98
R1573:Crb1 UTSW 1 139337606 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139234779 missense probably benign
R1728:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1728:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1729:Crb1 UTSW 1 139234779 missense probably benign
R1729:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1729:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1730:Crb1 UTSW 1 139234779 missense probably benign
R1730:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1730:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1739:Crb1 UTSW 1 139234779 missense probably benign
R1739:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1739:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1762:Crb1 UTSW 1 139234779 missense probably benign
R1762:Crb1 UTSW 1 139237531 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1762:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1783:Crb1 UTSW 1 139234779 missense probably benign
R1783:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1783:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1784:Crb1 UTSW 1 139234779 missense probably benign
R1784:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1784:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1785:Crb1 UTSW 1 139234779 missense probably benign
R1785:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1785:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1848:Crb1 UTSW 1 139237012 missense probably damaging 0.97
R1894:Crb1 UTSW 1 139243193 missense probably benign 0.02
R2057:Crb1 UTSW 1 139314750 missense probably damaging 1.00
R2136:Crb1 UTSW 1 139337425 missense probably benign 0.03
R2140:Crb1 UTSW 1 139237012 missense probably benign 0.01
R2363:Crb1 UTSW 1 139337278 missense possibly damaging 0.89
R3605:Crb1 UTSW 1 139237339 missense probably damaging 1.00
R3817:Crb1 UTSW 1 139248097 missense probably benign
R3942:Crb1 UTSW 1 139337473 missense possibly damaging 0.49
R4272:Crb1 UTSW 1 139323311 missense probably benign 0.04
R4301:Crb1 UTSW 1 139248830 missense probably benign 0.01
R4403:Crb1 UTSW 1 139248379 missense probably benign 0.00
R4700:Crb1 UTSW 1 139198771 missense probably damaging 0.96
R4771:Crb1 UTSW 1 139328204 missense probably damaging 1.00
R4845:Crb1 UTSW 1 139243034 missense probably benign 0.06
R4867:Crb1 UTSW 1 139243014 missense probably damaging 1.00
R5159:Crb1 UTSW 1 139243018 missense probably damaging 0.99
R5270:Crb1 UTSW 1 139236864 missense probably damaging 0.97
R5347:Crb1 UTSW 1 139337371 missense probably damaging 1.00
R5513:Crb1 UTSW 1 139236821 critical splice donor site probably null
R5641:Crb1 UTSW 1 139248889 missense probably damaging 0.99
R5754:Crb1 UTSW 1 139231599 missense probably damaging 1.00
R5968:Crb1 UTSW 1 139243001 missense probably damaging 1.00
R6122:Crb1 UTSW 1 139248948 nonsense probably null
R6369:Crb1 UTSW 1 139237462 missense probably damaging 1.00
R6809:Crb1 UTSW 1 139243126 missense probably benign 0.00
X0066:Crb1 UTSW 1 139248245 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ATCCAGCGAATTCCGTAGAGTCCC -3'
(R):5'- TAAAGACCCTGAGCACCCTGTCTG -3'

Sequencing Primer
(F):5'- CCGTAGAGTCCCAGAGATTTTAGC -3'
(R):5'- CCTCCTGGATATGCTGGAAG -3'
Posted On2013-09-03