Incidental Mutation 'R0734:Psip1'
ID68136
Institutional Source Beutler Lab
Gene Symbol Psip1
Ensembl Gene ENSMUSG00000028484
Gene NamePC4 and SFRS1 interacting protein 1
SynonymsPsip2
MMRRC Submission 038915-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.648) question?
Stock #R0734 (G1)
Quality Score143
Status Validated
Chromosome4
Chromosomal Location83455680-83486459 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 83463588 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030207] [ENSMUST00000107214] [ENSMUST00000107215] [ENSMUST00000123262] [ENSMUST00000124856] [ENSMUST00000143533]
Predicted Effect probably benign
Transcript: ENSMUST00000030207
SMART Domains Protein: ENSMUSP00000030207
Gene: ENSMUSG00000028484

DomainStartEndE-ValueType
PWWP 5 62 1.98e-17 SMART
low complexity region 143 155 N/A INTRINSIC
low complexity region 212 255 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 327 343 N/A INTRINSIC
Pfam:LEDGF 347 448 4.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107214
SMART Domains Protein: ENSMUSP00000102832
Gene: ENSMUSG00000028484

DomainStartEndE-ValueType
PWWP 5 62 1.98e-17 SMART
low complexity region 143 155 N/A INTRINSIC
low complexity region 212 255 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107215
SMART Domains Protein: ENSMUSP00000102833
Gene: ENSMUSG00000028484

DomainStartEndE-ValueType
PWWP 5 62 1.98e-17 SMART
low complexity region 143 155 N/A INTRINSIC
low complexity region 212 255 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 316 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123262
SMART Domains Protein: ENSMUSP00000124038
Gene: ENSMUSG00000028483

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124856
SMART Domains Protein: ENSMUSP00000124181
Gene: ENSMUSG00000028483

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126706
SMART Domains Protein: ENSMUSP00000120799
Gene: ENSMUSG00000028484

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130676
Predicted Effect probably benign
Transcript: ENSMUST00000143533
SMART Domains Protein: ENSMUSP00000123793
Gene: ENSMUSG00000028483

DomainStartEndE-ValueType
Pfam:zf-SNAP50_C 197 403 3.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160742
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene tend to die perinatally. Survivors show reduced fertility and a variety of skeletal and behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,850,334 S530T probably benign Het
Acer2 G T 4: 86,917,559 K223N probably benign Het
Adam19 T G 11: 46,127,403 C431G probably damaging Het
Adamts16 T G 13: 70,738,481 probably benign Het
Aox2 A T 1: 58,305,341 E531V probably benign Het
Apaf1 A T 10: 91,037,021 N720K probably benign Het
Atrnl1 T A 19: 57,654,861 W394R probably damaging Het
Bcl6 T C 16: 23,968,139 E634G probably damaging Het
Cfap65 T A 1: 74,918,887 Y954F probably damaging Het
Cobl A G 11: 12,375,971 V168A probably damaging Het
Cped1 C T 6: 22,085,041 P210S probably damaging Het
Crb1 C T 1: 139,337,084 V199M probably benign Het
Cyp2j6 A T 4: 96,523,844 probably benign Het
Dhrs3 C G 4: 144,927,176 S289W probably damaging Het
Dido1 T G 2: 180,660,042 Q2023P probably benign Het
Dlg4 G A 11: 70,042,705 G550R probably damaging Het
Dnah12 C A 14: 26,800,013 H1928N probably benign Het
Dthd1 A C 5: 62,839,410 probably benign Het
Erg C A 16: 95,370,025 G269C possibly damaging Het
Erich6 G A 3: 58,629,388 probably benign Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fancc T C 13: 63,331,842 R300G probably damaging Het
Fcer1g T A 1: 171,231,179 K47* probably null Het
Flt4 A G 11: 49,626,717 T289A possibly damaging Het
Gcnt2 T A 13: 40,860,521 F56Y probably benign Het
Gpatch8 G T 11: 102,481,400 S437R unknown Het
Grin2a T A 16: 9,579,611 I871F possibly damaging Het
Hsd17b4 T C 18: 50,170,777 V439A possibly damaging Het
Hykk A T 9: 54,946,432 K346M possibly damaging Het
Ifi208 T C 1: 173,683,335 L352S probably damaging Het
Ikzf1 T C 11: 11,758,195 V110A probably damaging Het
Irak3 A T 10: 120,145,637 probably benign Het
Lamp5 T A 2: 136,059,030 V50E probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch3 C T 16: 32,997,483 R570* probably null Het
Map1lc3a T C 2: 155,276,976 V20A possibly damaging Het
Map3k14 C A 11: 103,227,000 K655N probably benign Het
Mark2 A G 19: 7,285,981 probably benign Het
Mbtd1 G A 11: 93,923,146 G205D probably damaging Het
Med13 T C 11: 86,301,237 T861A probably benign Het
Meltf T A 16: 31,881,958 Y99N probably damaging Het
Mex3d G A 10: 80,381,532 T617I possibly damaging Het
Muc13 G A 16: 33,803,082 V249I probably damaging Het
Myo18a C A 11: 77,847,404 P1688Q probably damaging Het
Naaladl1 A T 19: 6,112,874 probably null Het
Ncoa3 T A 2: 166,069,191 probably benign Het
Nf2 T C 11: 4,820,409 T67A probably benign Het
Nin A G 12: 70,030,113 V1056A probably benign Het
Olfr1426 T A 19: 12,088,119 R224S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr59 A T 11: 74,288,946 Q100L probably damaging Het
P3h1 T C 4: 119,238,688 L331P probably damaging Het
Pabpc4l T C 3: 46,446,973 K79E possibly damaging Het
Pam T A 1: 97,864,362 R445* probably null Het
Pcdhb6 T C 18: 37,335,334 I436T probably damaging Het
Piezo2 A G 18: 63,041,723 Y1987H probably damaging Het
Plch2 G A 4: 154,996,283 T477I probably damaging Het
Postn G A 3: 54,362,715 G72R probably damaging Het
Proca1 G A 11: 78,201,802 probably benign Het
Ptprd G A 4: 76,140,597 P153L probably damaging Het
Rgl1 T C 1: 152,554,300 D242G probably damaging Het
Ric1 T A 19: 29,594,818 I671K possibly damaging Het
Rxrg T A 1: 167,627,444 C199S probably damaging Het
Sec24c A C 14: 20,693,745 D1006A probably damaging Het
Sec63 A G 10: 42,796,208 T173A probably benign Het
Sfxn5 T C 6: 85,267,865 probably benign Het
Spam1 A G 6: 24,796,949 I300V probably benign Het
Spem1 A G 11: 69,821,271 L189P probably damaging Het
Sptbn2 A T 19: 4,748,123 R1959* probably null Het
Timeless C T 10: 128,250,060 R935W probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim24 T C 6: 37,919,465 Y286H possibly damaging Het
Ttyh2 A G 11: 114,710,193 probably benign Het
Zbtb21 C T 16: 97,952,627 C180Y probably damaging Het
Zfp746 T C 6: 48,064,899 T298A probably damaging Het
Other mutations in Psip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02414:Psip1 APN 4 83468637 missense probably benign 0.00
IGL02801:Psip1 APN 4 83458120 missense probably benign 0.02
IGL02995:Psip1 APN 4 83463717 intron probably benign
IGL03070:Psip1 APN 4 83465081 missense probably damaging 0.99
IGL03381:Psip1 APN 4 83485785 missense probably benign 0.03
R0167:Psip1 UTSW 4 83466818 unclassified probably null
R0288:Psip1 UTSW 4 83464959 missense probably damaging 1.00
R0365:Psip1 UTSW 4 83485712 splice site probably null
R0514:Psip1 UTSW 4 83460037 missense probably damaging 1.00
R0590:Psip1 UTSW 4 83458144 missense probably benign 0.00
R0774:Psip1 UTSW 4 83460452 frame shift probably null
R1016:Psip1 UTSW 4 83459898 missense possibly damaging 0.48
R1256:Psip1 UTSW 4 83474367 missense probably benign
R1819:Psip1 UTSW 4 83458163 missense probably benign 0.01
R1993:Psip1 UTSW 4 83482532 missense probably damaging 0.99
R5423:Psip1 UTSW 4 83460130 intron probably benign
R5940:Psip1 UTSW 4 83476322 missense probably damaging 1.00
R6173:Psip1 UTSW 4 83473049 unclassified probably null
R6200:Psip1 UTSW 4 83474373 missense probably benign 0.20
R6809:Psip1 UTSW 4 83468642 missense probably benign 0.00
R7488:Psip1 UTSW 4 83473038 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCACAAGAGCCGTGATGTCTAATG -3'
(R):5'- TCCAGTCAGTAGACCTGTGTTCCTG -3'

Sequencing Primer
(F):5'- GCTTGAGTCATACAGGATCTAGCC -3'
(R):5'- TTAGTCTCCAACCACTAACTTGAGAG -3'
Posted On2013-09-03