Incidental Mutation 'R0734:Dthd1'
ID68142
Institutional Source Beutler Lab
Gene Symbol Dthd1
Ensembl Gene ENSMUSG00000090326
Gene Namedeath domain containing 1
SynonymsGm17384
MMRRC Submission 038915-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R0734 (G1)
Quality Score192
Status Validated
Chromosome5
Chromosomal Location62813823-62888308 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 62839410 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170704]
Predicted Effect probably benign
Transcript: ENSMUST00000170704
SMART Domains Protein: ENSMUSP00000131534
Gene: ENSMUSG00000090326

DomainStartEndE-ValueType
Pfam:Death 693 778 4.2e-12 PFAM
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a death domain. Death domain-containing proteins function in signaling pathways and formation of signaling complexes, as well as the apoptosis pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,850,334 S530T probably benign Het
Acer2 G T 4: 86,917,559 K223N probably benign Het
Adam19 T G 11: 46,127,403 C431G probably damaging Het
Adamts16 T G 13: 70,738,481 probably benign Het
Aox2 A T 1: 58,305,341 E531V probably benign Het
Apaf1 A T 10: 91,037,021 N720K probably benign Het
Atrnl1 T A 19: 57,654,861 W394R probably damaging Het
Bcl6 T C 16: 23,968,139 E634G probably damaging Het
Cfap65 T A 1: 74,918,887 Y954F probably damaging Het
Cobl A G 11: 12,375,971 V168A probably damaging Het
Cped1 C T 6: 22,085,041 P210S probably damaging Het
Crb1 C T 1: 139,337,084 V199M probably benign Het
Cyp2j6 A T 4: 96,523,844 probably benign Het
Dhrs3 C G 4: 144,927,176 S289W probably damaging Het
Dido1 T G 2: 180,660,042 Q2023P probably benign Het
Dlg4 G A 11: 70,042,705 G550R probably damaging Het
Dnah12 C A 14: 26,800,013 H1928N probably benign Het
Erg C A 16: 95,370,025 G269C possibly damaging Het
Erich6 G A 3: 58,629,388 probably benign Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fancc T C 13: 63,331,842 R300G probably damaging Het
Fcer1g T A 1: 171,231,179 K47* probably null Het
Flt4 A G 11: 49,626,717 T289A possibly damaging Het
Gcnt2 T A 13: 40,860,521 F56Y probably benign Het
Gpatch8 G T 11: 102,481,400 S437R unknown Het
Grin2a T A 16: 9,579,611 I871F possibly damaging Het
Hsd17b4 T C 18: 50,170,777 V439A possibly damaging Het
Hykk A T 9: 54,946,432 K346M possibly damaging Het
Ifi208 T C 1: 173,683,335 L352S probably damaging Het
Ikzf1 T C 11: 11,758,195 V110A probably damaging Het
Irak3 A T 10: 120,145,637 probably benign Het
Lamp5 T A 2: 136,059,030 V50E probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch3 C T 16: 32,997,483 R570* probably null Het
Map1lc3a T C 2: 155,276,976 V20A possibly damaging Het
Map3k14 C A 11: 103,227,000 K655N probably benign Het
Mark2 A G 19: 7,285,981 probably benign Het
Mbtd1 G A 11: 93,923,146 G205D probably damaging Het
Med13 T C 11: 86,301,237 T861A probably benign Het
Meltf T A 16: 31,881,958 Y99N probably damaging Het
Mex3d G A 10: 80,381,532 T617I possibly damaging Het
Muc13 G A 16: 33,803,082 V249I probably damaging Het
Myo18a C A 11: 77,847,404 P1688Q probably damaging Het
Naaladl1 A T 19: 6,112,874 probably null Het
Ncoa3 T A 2: 166,069,191 probably benign Het
Nf2 T C 11: 4,820,409 T67A probably benign Het
Nin A G 12: 70,030,113 V1056A probably benign Het
Olfr1426 T A 19: 12,088,119 R224S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr59 A T 11: 74,288,946 Q100L probably damaging Het
P3h1 T C 4: 119,238,688 L331P probably damaging Het
Pabpc4l T C 3: 46,446,973 K79E possibly damaging Het
Pam T A 1: 97,864,362 R445* probably null Het
Pcdhb6 T C 18: 37,335,334 I436T probably damaging Het
Piezo2 A G 18: 63,041,723 Y1987H probably damaging Het
Plch2 G A 4: 154,996,283 T477I probably damaging Het
Postn G A 3: 54,362,715 G72R probably damaging Het
Proca1 G A 11: 78,201,802 probably benign Het
Psip1 T A 4: 83,463,588 probably benign Het
Ptprd G A 4: 76,140,597 P153L probably damaging Het
Rgl1 T C 1: 152,554,300 D242G probably damaging Het
Ric1 T A 19: 29,594,818 I671K possibly damaging Het
Rxrg T A 1: 167,627,444 C199S probably damaging Het
Sec24c A C 14: 20,693,745 D1006A probably damaging Het
Sec63 A G 10: 42,796,208 T173A probably benign Het
Sfxn5 T C 6: 85,267,865 probably benign Het
Spam1 A G 6: 24,796,949 I300V probably benign Het
Spem1 A G 11: 69,821,271 L189P probably damaging Het
Sptbn2 A T 19: 4,748,123 R1959* probably null Het
Timeless C T 10: 128,250,060 R935W probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim24 T C 6: 37,919,465 Y286H possibly damaging Het
Ttyh2 A G 11: 114,710,193 probably benign Het
Zbtb21 C T 16: 97,952,627 C180Y probably damaging Het
Zfp746 T C 6: 48,064,899 T298A probably damaging Het
Other mutations in Dthd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:Dthd1 UTSW 5 62843026 small insertion probably benign
FR4342:Dthd1 UTSW 5 62843026 small insertion probably benign
FR4589:Dthd1 UTSW 5 62843026 frame shift probably null
FR4976:Dthd1 UTSW 5 62843024 small insertion probably benign
R0096:Dthd1 UTSW 5 62843040 missense possibly damaging 0.75
R0096:Dthd1 UTSW 5 62843040 missense possibly damaging 0.75
R0395:Dthd1 UTSW 5 62814333 missense possibly damaging 0.71
R0899:Dthd1 UTSW 5 62842928 missense probably benign 0.01
R0970:Dthd1 UTSW 5 62887981 missense probably damaging 1.00
R1104:Dthd1 UTSW 5 62821959 missense probably damaging 1.00
R1518:Dthd1 UTSW 5 62822040 missense probably damaging 1.00
R1831:Dthd1 UTSW 5 62827229 missense probably benign 0.02
R2110:Dthd1 UTSW 5 62821908 missense probably damaging 1.00
R2110:Dthd1 UTSW 5 62842879 missense probably damaging 0.99
R2112:Dthd1 UTSW 5 62821908 missense probably damaging 1.00
R2112:Dthd1 UTSW 5 62842879 missense probably damaging 0.99
R2248:Dthd1 UTSW 5 62849900 missense probably damaging 0.99
R2311:Dthd1 UTSW 5 62839237 splice site probably benign
R2937:Dthd1 UTSW 5 62842957 missense probably benign 0.02
R2938:Dthd1 UTSW 5 62842957 missense probably benign 0.02
R3835:Dthd1 UTSW 5 62849785 missense probably damaging 1.00
R3855:Dthd1 UTSW 5 62827129 missense probably benign 0.21
R3855:Dthd1 UTSW 5 62888023 missense probably benign 0.00
R4049:Dthd1 UTSW 5 62827165 nonsense probably null
R4321:Dthd1 UTSW 5 62818690 missense probably damaging 0.99
R4353:Dthd1 UTSW 5 62842867 missense probably benign 0.04
R4560:Dthd1 UTSW 5 62827092 missense probably damaging 1.00
R4613:Dthd1 UTSW 5 62827068 missense probably damaging 1.00
R4689:Dthd1 UTSW 5 62842912 missense probably damaging 0.99
R4715:Dthd1 UTSW 5 62888187 missense probably benign
R4718:Dthd1 UTSW 5 62818793 missense probably damaging 1.00
R4967:Dthd1 UTSW 5 62888206 missense probably benign 0.01
R5068:Dthd1 UTSW 5 62818716 missense probably benign
R5089:Dthd1 UTSW 5 62849905 missense probably benign
R5355:Dthd1 UTSW 5 62839387 missense probably damaging 1.00
R5470:Dthd1 UTSW 5 62818766 missense probably damaging 1.00
R6284:Dthd1 UTSW 5 62814041 missense possibly damaging 0.71
R6293:Dthd1 UTSW 5 62842850 missense probably damaging 0.99
R6484:Dthd1 UTSW 5 62814332 missense probably benign 0.34
R6516:Dthd1 UTSW 5 62839264 missense probably benign 0.16
R6741:Dthd1 UTSW 5 62842946 missense probably damaging 1.00
R6810:Dthd1 UTSW 5 62814329 missense probably benign 0.01
R7565:Dthd1 UTSW 5 62843092 missense not run
Predicted Primers PCR Primer
(F):5'- TCTCCGAAAACCTGGTAACAGTGC -3'
(R):5'- TCCAACATGCTCCTTTAATGGCCTG -3'

Sequencing Primer
(F):5'- CCTGGTAACAGTGCATGTGAAAC -3'
(R):5'- CCTTTAATGGCCTGTCTAGAGAAC -3'
Posted On2013-09-03