Incidental Mutation 'R0734:Apaf1'
ID68151
Institutional Source Beutler Lab
Gene Symbol Apaf1
Ensembl Gene ENSMUSG00000019979
Gene Nameapoptotic peptidase activating factor 1
SynonymsApaf1l, 6230400I06Rik
MMRRC Submission 038915-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0734 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location90989311-91082770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91037021 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 720 (N720K)
Ref Sequence ENSEMBL: ENSMUSP00000124134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000162618]
Predicted Effect probably benign
Transcript: ENSMUST00000020157
AA Change: N731K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: N731K

DomainStartEndE-ValueType
Pfam:CARD 6 90 7.3e-22 PFAM
Pfam:NB-ARC 129 414 1.7e-77 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159110
AA Change: N731K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: N731K

DomainStartEndE-ValueType
Pfam:CARD 6 90 7.4e-21 PFAM
Pfam:NB-ARC 129 414 6.9e-71 PFAM
WD40 604 643 1.35e-5 SMART
WD40 646 685 1.04e-11 SMART
WD40 688 729 2.98e-7 SMART
WD40 732 771 9.88e-13 SMART
WD40 780 825 1.28e1 SMART
WD40 828 868 1.43e0 SMART
WD40 871 910 3.24e-8 SMART
WD40 952 989 2.57e0 SMART
WD40 992 1031 1.09e-5 SMART
WD40 1033 1071 2.09e-2 SMART
WD40 1074 1113 2.93e-6 SMART
WD40 1116 1155 8.55e-8 SMART
WD40 1168 1204 4.55e-3 SMART
Blast:WD40 1207 1246 5e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162618
AA Change: N720K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: N720K

DomainStartEndE-ValueType
Pfam:CARD 6 90 1.1e-20 PFAM
Pfam:NB-ARC 118 403 8.8e-72 PFAM
WD40 593 632 1.35e-5 SMART
WD40 635 674 1.04e-11 SMART
WD40 677 718 2.98e-7 SMART
WD40 721 760 9.88e-13 SMART
WD40 769 814 1.28e1 SMART
WD40 817 857 1.43e0 SMART
WD40 860 899 3.24e-8 SMART
WD40 941 978 2.57e0 SMART
WD40 981 1020 1.09e-5 SMART
WD40 1022 1060 2.09e-2 SMART
WD40 1063 1102 2.93e-6 SMART
WD40 1105 1144 8.55e-8 SMART
WD40 1157 1193 4.55e-3 SMART
Blast:WD40 1196 1235 5e-18 BLAST
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,850,334 S530T probably benign Het
Acer2 G T 4: 86,917,559 K223N probably benign Het
Adam19 T G 11: 46,127,403 C431G probably damaging Het
Adamts16 T G 13: 70,738,481 probably benign Het
Aox2 A T 1: 58,305,341 E531V probably benign Het
Atrnl1 T A 19: 57,654,861 W394R probably damaging Het
Bcl6 T C 16: 23,968,139 E634G probably damaging Het
Cfap65 T A 1: 74,918,887 Y954F probably damaging Het
Cobl A G 11: 12,375,971 V168A probably damaging Het
Cped1 C T 6: 22,085,041 P210S probably damaging Het
Crb1 C T 1: 139,337,084 V199M probably benign Het
Cyp2j6 A T 4: 96,523,844 probably benign Het
Dhrs3 C G 4: 144,927,176 S289W probably damaging Het
Dido1 T G 2: 180,660,042 Q2023P probably benign Het
Dlg4 G A 11: 70,042,705 G550R probably damaging Het
Dnah12 C A 14: 26,800,013 H1928N probably benign Het
Dthd1 A C 5: 62,839,410 probably benign Het
Erg C A 16: 95,370,025 G269C possibly damaging Het
Erich6 G A 3: 58,629,388 probably benign Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fancc T C 13: 63,331,842 R300G probably damaging Het
Fcer1g T A 1: 171,231,179 K47* probably null Het
Flt4 A G 11: 49,626,717 T289A possibly damaging Het
Gcnt2 T A 13: 40,860,521 F56Y probably benign Het
Gpatch8 G T 11: 102,481,400 S437R unknown Het
Grin2a T A 16: 9,579,611 I871F possibly damaging Het
Hsd17b4 T C 18: 50,170,777 V439A possibly damaging Het
Hykk A T 9: 54,946,432 K346M possibly damaging Het
Ifi208 T C 1: 173,683,335 L352S probably damaging Het
Ikzf1 T C 11: 11,758,195 V110A probably damaging Het
Irak3 A T 10: 120,145,637 probably benign Het
Lamp5 T A 2: 136,059,030 V50E probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch3 C T 16: 32,997,483 R570* probably null Het
Map1lc3a T C 2: 155,276,976 V20A possibly damaging Het
Map3k14 C A 11: 103,227,000 K655N probably benign Het
Mark2 A G 19: 7,285,981 probably benign Het
Mbtd1 G A 11: 93,923,146 G205D probably damaging Het
Med13 T C 11: 86,301,237 T861A probably benign Het
Meltf T A 16: 31,881,958 Y99N probably damaging Het
Mex3d G A 10: 80,381,532 T617I possibly damaging Het
Muc13 G A 16: 33,803,082 V249I probably damaging Het
Myo18a C A 11: 77,847,404 P1688Q probably damaging Het
Naaladl1 A T 19: 6,112,874 probably null Het
Ncoa3 T A 2: 166,069,191 probably benign Het
Nf2 T C 11: 4,820,409 T67A probably benign Het
Nin A G 12: 70,030,113 V1056A probably benign Het
Olfr1426 T A 19: 12,088,119 R224S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr59 A T 11: 74,288,946 Q100L probably damaging Het
P3h1 T C 4: 119,238,688 L331P probably damaging Het
Pabpc4l T C 3: 46,446,973 K79E possibly damaging Het
Pam T A 1: 97,864,362 R445* probably null Het
Pcdhb6 T C 18: 37,335,334 I436T probably damaging Het
Piezo2 A G 18: 63,041,723 Y1987H probably damaging Het
Plch2 G A 4: 154,996,283 T477I probably damaging Het
Postn G A 3: 54,362,715 G72R probably damaging Het
Proca1 G A 11: 78,201,802 probably benign Het
Psip1 T A 4: 83,463,588 probably benign Het
Ptprd G A 4: 76,140,597 P153L probably damaging Het
Rgl1 T C 1: 152,554,300 D242G probably damaging Het
Ric1 T A 19: 29,594,818 I671K possibly damaging Het
Rxrg T A 1: 167,627,444 C199S probably damaging Het
Sec24c A C 14: 20,693,745 D1006A probably damaging Het
Sec63 A G 10: 42,796,208 T173A probably benign Het
Sfxn5 T C 6: 85,267,865 probably benign Het
Spam1 A G 6: 24,796,949 I300V probably benign Het
Spem1 A G 11: 69,821,271 L189P probably damaging Het
Sptbn2 A T 19: 4,748,123 R1959* probably null Het
Timeless C T 10: 128,250,060 R935W probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim24 T C 6: 37,919,465 Y286H possibly damaging Het
Ttyh2 A G 11: 114,710,193 probably benign Het
Zbtb21 C T 16: 97,952,627 C180Y probably damaging Het
Zfp746 T C 6: 48,064,899 T298A probably damaging Het
Other mutations in Apaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Apaf1 APN 10 91023788 missense probably damaging 0.99
IGL00819:Apaf1 APN 10 90997340 splice site probably null
IGL01481:Apaf1 APN 10 91031588 missense possibly damaging 0.84
IGL01713:Apaf1 APN 10 91061832 splice site probably benign
IGL01715:Apaf1 APN 10 91058354 missense probably benign 0.20
IGL02152:Apaf1 APN 10 91061819 missense probably benign 0.24
IGL02331:Apaf1 APN 10 91059619 missense probably damaging 1.00
IGL03071:Apaf1 APN 10 90997255 missense possibly damaging 0.88
IGL03101:Apaf1 APN 10 91031559 missense possibly damaging 0.89
IGL03244:Apaf1 APN 10 91049349 splice site probably benign
Mayhem UTSW 10 90999719 missense probably damaging 0.99
wipeout UTSW 10 91056000 missense probably damaging 1.00
R0520:Apaf1 UTSW 10 91079989 missense probably damaging 0.99
R0600:Apaf1 UTSW 10 91060052 missense probably damaging 1.00
R0607:Apaf1 UTSW 10 91009203 missense probably damaging 1.00
R0688:Apaf1 UTSW 10 91061705 missense possibly damaging 0.94
R1256:Apaf1 UTSW 10 91058406 missense probably benign
R1459:Apaf1 UTSW 10 91062160 missense probably benign 0.00
R1485:Apaf1 UTSW 10 91060243 missense probably benign 0.02
R1511:Apaf1 UTSW 10 91060185 missense possibly damaging 0.81
R1531:Apaf1 UTSW 10 91054521 missense probably damaging 1.00
R1705:Apaf1 UTSW 10 91067271 splice site probably benign
R1919:Apaf1 UTSW 10 91077614 nonsense probably null
R1925:Apaf1 UTSW 10 90999719 missense probably damaging 0.99
R2001:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2002:Apaf1 UTSW 10 91061814 missense possibly damaging 0.94
R2006:Apaf1 UTSW 10 91061772 missense probably damaging 1.00
R2043:Apaf1 UTSW 10 91037028 missense probably damaging 1.00
R2073:Apaf1 UTSW 10 91031694 nonsense probably null
R2101:Apaf1 UTSW 10 91060080 missense probably benign 0.26
R2130:Apaf1 UTSW 10 91060165 nonsense probably null
R2153:Apaf1 UTSW 10 91048090 missense probably damaging 1.00
R2377:Apaf1 UTSW 10 91079893 missense possibly damaging 0.95
R2421:Apaf1 UTSW 10 91020723 missense probably damaging 1.00
R3835:Apaf1 UTSW 10 91059587 missense probably benign 0.07
R4750:Apaf1 UTSW 10 91060188 missense probably damaging 1.00
R5100:Apaf1 UTSW 10 90997287 missense probably benign
R5135:Apaf1 UTSW 10 91060094 missense probably damaging 1.00
R5497:Apaf1 UTSW 10 90999656 missense probably damaging 1.00
R5511:Apaf1 UTSW 10 91054392 missense probably damaging 1.00
R5659:Apaf1 UTSW 10 91062153 nonsense probably null
R5730:Apaf1 UTSW 10 91020771 missense possibly damaging 0.62
R6176:Apaf1 UTSW 10 91059571 critical splice donor site probably null
R6242:Apaf1 UTSW 10 91062163 missense probably damaging 1.00
R6292:Apaf1 UTSW 10 90991563 missense possibly damaging 0.86
R6376:Apaf1 UTSW 10 91023811 missense probably damaging 1.00
R6534:Apaf1 UTSW 10 91056000 missense probably damaging 1.00
R6975:Apaf1 UTSW 10 91020734 missense probably damaging 0.97
R7218:Apaf1 UTSW 10 91037002 missense probably damaging 1.00
R7369:Apaf1 UTSW 10 91001036 missense probably damaging 0.97
R7409:Apaf1 UTSW 10 91067246 missense probably damaging 1.00
R7413:Apaf1 UTSW 10 90995680 missense probably benign 0.28
R7418:Apaf1 UTSW 10 91023835 missense probably benign 0.09
R7423:Apaf1 UTSW 10 91059606 missense probably damaging 1.00
R7488:Apaf1 UTSW 10 91054380 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TCACCACAGACCATAAGGGCTTCTC -3'
(R):5'- AGACCCGTCGGCAGTTTGATTTAC -3'

Sequencing Primer
(F):5'- CTAAAGTTAGAGCCCTCTCGTGATG -3'
(R):5'- AGTGTATCCTGATCATATCCAACC -3'
Posted On2013-09-03