Incidental Mutation 'R0734:Irak3'
ID68152
Institutional Source Beutler Lab
Gene Symbol Irak3
Ensembl Gene ENSMUSG00000020227
Gene Nameinterleukin-1 receptor-associated kinase 3
Synonyms4833428C18Rik, IRAK-M
MMRRC Submission 038915-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R0734 (G1)
Quality Score180
Status Validated
Chromosome10
Chromosomal Location120141648-120202130 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 120145637 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020448] [ENSMUST00000135106] [ENSMUST00000145665]
Predicted Effect probably benign
Transcript: ENSMUST00000020448
SMART Domains Protein: ENSMUSP00000020448
Gene: ENSMUSG00000020227

DomainStartEndE-ValueType
Pfam:Death 26 106 1.3e-15 PFAM
Pfam:Pkinase 178 456 8.4e-37 PFAM
Pfam:Pkinase_Tyr 178 456 2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135106
SMART Domains Protein: ENSMUSP00000123604
Gene: ENSMUSG00000020227

DomainStartEndE-ValueType
Pfam:Death 26 106 2.2e-16 PFAM
Pfam:Pkinase_Tyr 178 301 3.1e-15 PFAM
Pfam:Pkinase 178 302 4.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145665
SMART Domains Protein: ENSMUSP00000118038
Gene: ENSMUSG00000020227

DomainStartEndE-ValueType
Pfam:Pkinase 86 364 8.4e-35 PFAM
Pfam:Pkinase_Tyr 86 364 1.7e-34 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the interleukin-1 receptor-associated kinase protein family. Members of this family are essential components of the Toll/IL-R immune signal transduction pathways. This protein is primarily expressed in monocytes and macrophages and functions as a negative regulator of Toll-like receptor signaling. Mutations in this gene are associated with a susceptibility to asthma. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormal inflammatory responses to bacterial infections and loose bone mass with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,850,334 S530T probably benign Het
Acer2 G T 4: 86,917,559 K223N probably benign Het
Adam19 T G 11: 46,127,403 C431G probably damaging Het
Adamts16 T G 13: 70,738,481 probably benign Het
Aox2 A T 1: 58,305,341 E531V probably benign Het
Apaf1 A T 10: 91,037,021 N720K probably benign Het
Atrnl1 T A 19: 57,654,861 W394R probably damaging Het
Bcl6 T C 16: 23,968,139 E634G probably damaging Het
Cfap65 T A 1: 74,918,887 Y954F probably damaging Het
Cobl A G 11: 12,375,971 V168A probably damaging Het
Cped1 C T 6: 22,085,041 P210S probably damaging Het
Crb1 C T 1: 139,337,084 V199M probably benign Het
Cyp2j6 A T 4: 96,523,844 probably benign Het
Dhrs3 C G 4: 144,927,176 S289W probably damaging Het
Dido1 T G 2: 180,660,042 Q2023P probably benign Het
Dlg4 G A 11: 70,042,705 G550R probably damaging Het
Dnah12 C A 14: 26,800,013 H1928N probably benign Het
Dthd1 A C 5: 62,839,410 probably benign Het
Erg C A 16: 95,370,025 G269C possibly damaging Het
Erich6 G A 3: 58,629,388 probably benign Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fancc T C 13: 63,331,842 R300G probably damaging Het
Fcer1g T A 1: 171,231,179 K47* probably null Het
Flt4 A G 11: 49,626,717 T289A possibly damaging Het
Gcnt2 T A 13: 40,860,521 F56Y probably benign Het
Gpatch8 G T 11: 102,481,400 S437R unknown Het
Grin2a T A 16: 9,579,611 I871F possibly damaging Het
Hsd17b4 T C 18: 50,170,777 V439A possibly damaging Het
Hykk A T 9: 54,946,432 K346M possibly damaging Het
Ifi208 T C 1: 173,683,335 L352S probably damaging Het
Ikzf1 T C 11: 11,758,195 V110A probably damaging Het
Lamp5 T A 2: 136,059,030 V50E probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch3 C T 16: 32,997,483 R570* probably null Het
Map1lc3a T C 2: 155,276,976 V20A possibly damaging Het
Map3k14 C A 11: 103,227,000 K655N probably benign Het
Mark2 A G 19: 7,285,981 probably benign Het
Mbtd1 G A 11: 93,923,146 G205D probably damaging Het
Med13 T C 11: 86,301,237 T861A probably benign Het
Meltf T A 16: 31,881,958 Y99N probably damaging Het
Mex3d G A 10: 80,381,532 T617I possibly damaging Het
Muc13 G A 16: 33,803,082 V249I probably damaging Het
Myo18a C A 11: 77,847,404 P1688Q probably damaging Het
Naaladl1 A T 19: 6,112,874 probably null Het
Ncoa3 T A 2: 166,069,191 probably benign Het
Nf2 T C 11: 4,820,409 T67A probably benign Het
Nin A G 12: 70,030,113 V1056A probably benign Het
Olfr1426 T A 19: 12,088,119 R224S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr59 A T 11: 74,288,946 Q100L probably damaging Het
P3h1 T C 4: 119,238,688 L331P probably damaging Het
Pabpc4l T C 3: 46,446,973 K79E possibly damaging Het
Pam T A 1: 97,864,362 R445* probably null Het
Pcdhb6 T C 18: 37,335,334 I436T probably damaging Het
Piezo2 A G 18: 63,041,723 Y1987H probably damaging Het
Plch2 G A 4: 154,996,283 T477I probably damaging Het
Postn G A 3: 54,362,715 G72R probably damaging Het
Proca1 G A 11: 78,201,802 probably benign Het
Psip1 T A 4: 83,463,588 probably benign Het
Ptprd G A 4: 76,140,597 P153L probably damaging Het
Rgl1 T C 1: 152,554,300 D242G probably damaging Het
Ric1 T A 19: 29,594,818 I671K possibly damaging Het
Rxrg T A 1: 167,627,444 C199S probably damaging Het
Sec24c A C 14: 20,693,745 D1006A probably damaging Het
Sec63 A G 10: 42,796,208 T173A probably benign Het
Sfxn5 T C 6: 85,267,865 probably benign Het
Spam1 A G 6: 24,796,949 I300V probably benign Het
Spem1 A G 11: 69,821,271 L189P probably damaging Het
Sptbn2 A T 19: 4,748,123 R1959* probably null Het
Timeless C T 10: 128,250,060 R935W probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim24 T C 6: 37,919,465 Y286H possibly damaging Het
Ttyh2 A G 11: 114,710,193 probably benign Het
Zbtb21 C T 16: 97,952,627 C180Y probably damaging Het
Zfp746 T C 6: 48,064,899 T298A probably damaging Het
Other mutations in Irak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Irak3 APN 10 120178067 critical splice donor site probably null
IGL01015:Irak3 APN 10 120142790 nonsense probably null
IGL01530:Irak3 APN 10 120142794 missense probably benign 0.10
IGL01641:Irak3 APN 10 120176347 missense probably benign 0.35
IGL01730:Irak3 APN 10 120178100 missense probably benign 0.04
IGL02054:Irak3 APN 10 120176259 missense probably benign 0.01
IGL02938:Irak3 APN 10 120182524 critical splice donor site probably null
IGL02954:Irak3 APN 10 120176242 missense probably damaging 0.98
IGL02992:Irak3 APN 10 120182661 missense probably damaging 1.00
IGL03376:Irak3 APN 10 120146636 splice site probably benign
iracema UTSW 10 120145782 missense probably damaging 0.99
R0031:Irak3 UTSW 10 120176320 nonsense probably null
R1017:Irak3 UTSW 10 120142884 missense possibly damaging 0.94
R1025:Irak3 UTSW 10 120176346 missense probably damaging 1.00
R1486:Irak3 UTSW 10 120143061 missense probably damaging 1.00
R1538:Irak3 UTSW 10 120165130 missense probably benign 0.00
R1596:Irak3 UTSW 10 120182546 missense probably damaging 1.00
R1689:Irak3 UTSW 10 120146552 missense probably damaging 0.98
R2133:Irak3 UTSW 10 120165177 missense probably benign 0.10
R3609:Irak3 UTSW 10 120145677 missense possibly damaging 0.95
R3947:Irak3 UTSW 10 120170373 missense probably benign 0.00
R3948:Irak3 UTSW 10 120170373 missense probably benign 0.00
R4510:Irak3 UTSW 10 120145908 missense probably damaging 0.99
R4511:Irak3 UTSW 10 120145908 missense probably damaging 0.99
R4885:Irak3 UTSW 10 120182681 missense probably damaging 1.00
R5007:Irak3 UTSW 10 120146429 critical splice donor site probably null
R5180:Irak3 UTSW 10 120145782 missense probably damaging 0.99
R5704:Irak3 UTSW 10 120145689 missense probably benign 0.04
R5715:Irak3 UTSW 10 120142736 missense possibly damaging 0.66
R6020:Irak3 UTSW 10 120143137 missense probably damaging 1.00
R6916:Irak3 UTSW 10 120201365 missense probably damaging 1.00
R7182:Irak3 UTSW 10 120166511 missense probably damaging 1.00
X0023:Irak3 UTSW 10 120143187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTTCTACAACCACAGCAGG -3'
(R):5'- TGGATGACCCGAAACACGTTCAG -3'

Sequencing Primer
(F):5'- CCACAGCAGGAGTGTGAG -3'
(R):5'- TGTCTGATAGAGTCCCAGGAATC -3'
Posted On2013-09-03