Incidental Mutation 'R0734:Zbtb21'
ID68181
Institutional Source Beutler Lab
Gene Symbol Zbtb21
Ensembl Gene ENSMUSG00000046962
Gene Namezinc finger and BTB domain containing 21
SynonymsZfp295, B430213I24Rik, 5430437K12Rik, Znf295
MMRRC Submission 038915-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R0734 (G1)
Quality Score176
Status Validated
Chromosome16
Chromosomal Location97943357-97962622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97952627 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 180 (C180Y)
Ref Sequence ENSEMBL: ENSMUSP00000156042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052089] [ENSMUST00000063605] [ENSMUST00000113734] [ENSMUST00000231263] [ENSMUST00000231560] [ENSMUST00000232165] [ENSMUST00000232187]
Predicted Effect probably damaging
Transcript: ENSMUST00000052089
AA Change: C180Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052127
Gene: ENSMUSG00000046962
AA Change: C180Y

DomainStartEndE-ValueType
BTB 58 154 5.14e-18 SMART
low complexity region 461 470 N/A INTRINSIC
low complexity region 480 493 N/A INTRINSIC
ZnF_C2H2 578 598 2.14e2 SMART
ZnF_C2H2 605 628 8.67e-1 SMART
low complexity region 708 728 N/A INTRINSIC
ZnF_C2H2 737 757 2.06e1 SMART
ZnF_C2H2 765 787 4.65e-1 SMART
low complexity region 804 829 N/A INTRINSIC
ZnF_C2H2 871 893 1.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063605
AA Change: C152Y

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000068283
Gene: ENSMUSG00000046962
AA Change: C152Y

DomainStartEndE-ValueType
BTB 30 126 5.14e-18 SMART
low complexity region 433 442 N/A INTRINSIC
low complexity region 452 465 N/A INTRINSIC
ZnF_C2H2 549 572 8.09e-1 SMART
ZnF_C2H2 578 601 2.63e0 SMART
ZnF_C2H2 673 695 3.58e-2 SMART
ZnF_C2H2 750 770 2.14e2 SMART
ZnF_C2H2 777 800 8.67e-1 SMART
low complexity region 880 900 N/A INTRINSIC
ZnF_C2H2 909 929 2.06e1 SMART
ZnF_C2H2 937 959 4.65e-1 SMART
low complexity region 976 1001 N/A INTRINSIC
ZnF_C2H2 1043 1065 1.79e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113734
AA Change: C180Y

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109363
Gene: ENSMUSG00000046962
AA Change: C180Y

DomainStartEndE-ValueType
BTB 58 154 5.14e-18 SMART
low complexity region 461 470 N/A INTRINSIC
low complexity region 480 493 N/A INTRINSIC
ZnF_C2H2 577 600 8.09e-1 SMART
ZnF_C2H2 606 629 2.63e0 SMART
ZnF_C2H2 701 723 3.58e-2 SMART
ZnF_C2H2 778 798 2.14e2 SMART
ZnF_C2H2 805 828 8.67e-1 SMART
low complexity region 908 928 N/A INTRINSIC
ZnF_C2H2 937 957 2.06e1 SMART
ZnF_C2H2 965 987 4.65e-1 SMART
low complexity region 1004 1029 N/A INTRINSIC
ZnF_C2H2 1071 1093 1.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231256
Predicted Effect probably damaging
Transcript: ENSMUST00000231263
AA Change: C180Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000231560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232010
Predicted Effect probably benign
Transcript: ENSMUST00000232165
Predicted Effect probably benign
Transcript: ENSMUST00000232187
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,850,334 S530T probably benign Het
Acer2 G T 4: 86,917,559 K223N probably benign Het
Adam19 T G 11: 46,127,403 C431G probably damaging Het
Adamts16 T G 13: 70,738,481 probably benign Het
Aox2 A T 1: 58,305,341 E531V probably benign Het
Apaf1 A T 10: 91,037,021 N720K probably benign Het
Atrnl1 T A 19: 57,654,861 W394R probably damaging Het
Bcl6 T C 16: 23,968,139 E634G probably damaging Het
Cfap65 T A 1: 74,918,887 Y954F probably damaging Het
Cobl A G 11: 12,375,971 V168A probably damaging Het
Cped1 C T 6: 22,085,041 P210S probably damaging Het
Crb1 C T 1: 139,337,084 V199M probably benign Het
Cyp2j6 A T 4: 96,523,844 probably benign Het
Dhrs3 C G 4: 144,927,176 S289W probably damaging Het
Dido1 T G 2: 180,660,042 Q2023P probably benign Het
Dlg4 G A 11: 70,042,705 G550R probably damaging Het
Dnah12 C A 14: 26,800,013 H1928N probably benign Het
Dthd1 A C 5: 62,839,410 probably benign Het
Erg C A 16: 95,370,025 G269C possibly damaging Het
Erich6 G A 3: 58,629,388 probably benign Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fancc T C 13: 63,331,842 R300G probably damaging Het
Fcer1g T A 1: 171,231,179 K47* probably null Het
Flt4 A G 11: 49,626,717 T289A possibly damaging Het
Gcnt2 T A 13: 40,860,521 F56Y probably benign Het
Gpatch8 G T 11: 102,481,400 S437R unknown Het
Grin2a T A 16: 9,579,611 I871F possibly damaging Het
Hsd17b4 T C 18: 50,170,777 V439A possibly damaging Het
Hykk A T 9: 54,946,432 K346M possibly damaging Het
Ifi208 T C 1: 173,683,335 L352S probably damaging Het
Ikzf1 T C 11: 11,758,195 V110A probably damaging Het
Irak3 A T 10: 120,145,637 probably benign Het
Lamp5 T A 2: 136,059,030 V50E probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrch3 C T 16: 32,997,483 R570* probably null Het
Map1lc3a T C 2: 155,276,976 V20A possibly damaging Het
Map3k14 C A 11: 103,227,000 K655N probably benign Het
Mark2 A G 19: 7,285,981 probably benign Het
Mbtd1 G A 11: 93,923,146 G205D probably damaging Het
Med13 T C 11: 86,301,237 T861A probably benign Het
Meltf T A 16: 31,881,958 Y99N probably damaging Het
Mex3d G A 10: 80,381,532 T617I possibly damaging Het
Muc13 G A 16: 33,803,082 V249I probably damaging Het
Myo18a C A 11: 77,847,404 P1688Q probably damaging Het
Naaladl1 A T 19: 6,112,874 probably null Het
Ncoa3 T A 2: 166,069,191 probably benign Het
Nf2 T C 11: 4,820,409 T67A probably benign Het
Nin A G 12: 70,030,113 V1056A probably benign Het
Olfr1426 T A 19: 12,088,119 R224S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr59 A T 11: 74,288,946 Q100L probably damaging Het
P3h1 T C 4: 119,238,688 L331P probably damaging Het
Pabpc4l T C 3: 46,446,973 K79E possibly damaging Het
Pam T A 1: 97,864,362 R445* probably null Het
Pcdhb6 T C 18: 37,335,334 I436T probably damaging Het
Piezo2 A G 18: 63,041,723 Y1987H probably damaging Het
Plch2 G A 4: 154,996,283 T477I probably damaging Het
Postn G A 3: 54,362,715 G72R probably damaging Het
Proca1 G A 11: 78,201,802 probably benign Het
Psip1 T A 4: 83,463,588 probably benign Het
Ptprd G A 4: 76,140,597 P153L probably damaging Het
Rgl1 T C 1: 152,554,300 D242G probably damaging Het
Ric1 T A 19: 29,594,818 I671K possibly damaging Het
Rxrg T A 1: 167,627,444 C199S probably damaging Het
Sec24c A C 14: 20,693,745 D1006A probably damaging Het
Sec63 A G 10: 42,796,208 T173A probably benign Het
Sfxn5 T C 6: 85,267,865 probably benign Het
Spam1 A G 6: 24,796,949 I300V probably benign Het
Spem1 A G 11: 69,821,271 L189P probably damaging Het
Sptbn2 A T 19: 4,748,123 R1959* probably null Het
Timeless C T 10: 128,250,060 R935W probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim24 T C 6: 37,919,465 Y286H possibly damaging Het
Ttyh2 A G 11: 114,710,193 probably benign Het
Zfp746 T C 6: 48,064,899 T298A probably damaging Het
Other mutations in Zbtb21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Zbtb21 APN 16 97952320 missense probably benign 0.03
IGL00921:Zbtb21 APN 16 97952022 missense probably damaging 1.00
IGL01825:Zbtb21 APN 16 97952689 missense possibly damaging 0.63
IGL02310:Zbtb21 APN 16 97951790 missense possibly damaging 0.89
IGL03126:Zbtb21 APN 16 97951745 missense probably damaging 1.00
IGL03332:Zbtb21 APN 16 97952333 missense possibly damaging 0.94
R0165:Zbtb21 UTSW 16 97951404 missense probably damaging 1.00
R0184:Zbtb21 UTSW 16 97950513 missense probably damaging 1.00
R0267:Zbtb21 UTSW 16 97952100 missense probably damaging 1.00
R1546:Zbtb21 UTSW 16 97952027 missense probably damaging 0.97
R1565:Zbtb21 UTSW 16 97952427 missense probably benign 0.00
R1778:Zbtb21 UTSW 16 97950585 missense probably benign 0.02
R2049:Zbtb21 UTSW 16 97950155 missense probably damaging 1.00
R4086:Zbtb21 UTSW 16 97952763 missense probably damaging 1.00
R4619:Zbtb21 UTSW 16 97949892 missense possibly damaging 0.95
R4620:Zbtb21 UTSW 16 97949892 missense possibly damaging 0.95
R4754:Zbtb21 UTSW 16 97951266 missense probably damaging 1.00
R4785:Zbtb21 UTSW 16 97950455 missense possibly damaging 0.60
R5466:Zbtb21 UTSW 16 97950498 missense possibly damaging 0.66
R5989:Zbtb21 UTSW 16 97951499 missense probably damaging 1.00
R6374:Zbtb21 UTSW 16 97950368 missense probably damaging 0.98
R6469:Zbtb21 UTSW 16 97956772 missense probably benign 0.01
R6732:Zbtb21 UTSW 16 97951082 missense probably damaging 0.97
R6830:Zbtb21 UTSW 16 97951961 missense probably damaging 1.00
R7123:Zbtb21 UTSW 16 97949912 missense probably damaging 0.96
R7129:Zbtb21 UTSW 16 97951687 small deletion probably benign
R7261:Zbtb21 UTSW 16 97952979 missense possibly damaging 0.46
R7305:Zbtb21 UTSW 16 97951295 missense possibly damaging 0.92
R7372:Zbtb21 UTSW 16 97950369 missense possibly damaging 0.55
R7564:Zbtb21 UTSW 16 97951540 nonsense probably null
X0022:Zbtb21 UTSW 16 97952075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCAGCTCTATAGCTTTCCCC -3'
(R):5'- GTGAGCCTGACGCTTTTGACAAC -3'

Sequencing Primer
(F):5'- CCAGAGACTTTGCATATACTGC -3'
(R):5'- GACGCTTTTGACAACGTTCTG -3'
Posted On2013-09-03