Incidental Mutation 'R0735:Olfr661'
ID68231
Institutional Source Beutler Lab
Gene Symbol Olfr661
Ensembl Gene ENSMUSG00000073920
Gene Nameolfactory receptor 661
SynonymsMOR40-4, GA_x6K02T2PBJ9-7316375-7317334
MMRRC Submission 038916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0735 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104686501-104691354 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104688819 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 268 (H268L)
Ref Sequence ENSEMBL: ENSMUSP00000151208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098168] [ENSMUST00000214876]
Predicted Effect probably damaging
Transcript: ENSMUST00000098168
AA Change: H268L

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095770
Gene: ENSMUSG00000073920
AA Change: H268L

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 5.9e-74 PFAM
Pfam:7TM_GPCR_Srsx 41 312 2e-9 PFAM
Pfam:7tm_1 47 297 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211165
Predicted Effect probably damaging
Transcript: ENSMUST00000214876
AA Change: H268L

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215864
Meta Mutation Damage Score 0.0264 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 91.8%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,717,638 I1552K possibly damaging Het
Actr8 T A 14: 29,989,712 M405K probably benign Het
Adam10 G A 9: 70,748,251 V334I possibly damaging Het
Adgra2 G T 8: 27,117,318 G686C probably damaging Het
Akap11 A T 14: 78,510,078 I1623N probably damaging Het
Astn1 A T 1: 158,472,389 T100S possibly damaging Het
B3galt1 A C 2: 68,118,579 I213L possibly damaging Het
B4galnt4 A G 7: 141,064,323 K101E probably benign Het
Camsap2 A G 1: 136,292,888 S324P probably damaging Het
Chrnb4 A G 9: 55,043,800 S60P probably damaging Het
Cpne1 A G 2: 156,078,750 probably null Het
Cubn G A 2: 13,491,689 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cxcl15 T C 5: 90,801,294 M106T probably benign Het
Cyp2c23 A T 19: 44,016,810 M140K probably damaging Het
Dgke A G 11: 89,060,075 F104S probably benign Het
Dhx36 T A 3: 62,472,729 M849L probably benign Het
Dnah7a C T 1: 53,544,511 E1522K possibly damaging Het
Edil3 G T 13: 89,177,178 V219F probably damaging Het
Egln1 A G 8: 124,948,495 V187A possibly damaging Het
Fam193a T C 5: 34,439,378 I455T possibly damaging Het
Fdft1 A T 14: 63,163,420 I88N probably damaging Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Frs2 T A 10: 117,074,582 S292C probably damaging Het
Gm15448 T C 7: 3,821,782 T533A possibly damaging Het
Gpr107 T A 2: 31,171,994 F145I probably benign Het
Gpr153 T A 4: 152,279,373 C83* probably null Het
H2-Q7 T G 17: 35,440,186 probably null Het
Hsp90b1 A T 10: 86,695,748 probably benign Het
Kcnk1 C A 8: 126,025,289 N211K probably damaging Het
Klb T C 5: 65,379,727 V800A probably benign Het
Lat2 T C 5: 134,606,783 Y59C probably damaging Het
Mlkl A T 8: 111,327,801 probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtbp T A 15: 55,562,942 C93* probably null Het
Myo7a A G 7: 98,081,180 probably benign Het
Myt1 G A 2: 181,807,387 probably benign Het
Ogfrl1 T C 1: 23,375,754 Q224R possibly damaging Het
Olfr418 A G 1: 173,271,002 T276A probably benign Het
Osbpl2 A G 2: 180,150,290 probably benign Het
Plb1 C T 5: 32,284,920 T252M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn T C 6: 92,189,693 T657A probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rps6kb2 C A 19: 4,157,883 S348I probably benign Het
Rsrp1 C T 4: 134,924,257 R111W unknown Het
Ryr3 T C 2: 112,732,982 T2933A probably benign Het
Scara5 A G 14: 65,731,019 D247G possibly damaging Het
Slc7a11 C T 3: 50,424,096 S231N probably benign Het
Sod2 A T 17: 13,010,564 N91Y probably damaging Het
Spesp1 A T 9: 62,272,685 S314T probably benign Het
St3gal1 C A 15: 67,113,687 M39I probably benign Het
Stat6 A T 10: 127,658,241 I646F probably damaging Het
Tdrd1 A T 19: 56,865,978 K1119* probably null Het
Thbs2 A G 17: 14,679,815 I600T probably benign Het
Tor1a A G 2: 30,963,838 V160A probably damaging Het
Trdmt1 T G 2: 13,523,438 D104A probably benign Het
Trim58 T C 11: 58,651,393 V393A probably benign Het
Trip4 C T 9: 65,884,918 probably benign Het
Trip6 T C 5: 137,310,821 E341G probably benign Het
Ttn T A 2: 76,715,195 I32595F probably damaging Het
Ubr4 T A 4: 139,428,028 probably null Het
Ush2a G A 1: 188,864,693 V3877I probably benign Het
Vmn1r29 G T 6: 58,307,732 G146C probably damaging Het
Vmn2r53 A G 7: 12,581,780 V704A probably benign Het
Vmn2r7 C T 3: 64,716,367 M268I probably benign Het
Wnt7b G A 15: 85,537,495 T248M probably damaging Het
Xab2 G A 8: 3,613,649 P394S possibly damaging Het
Zfp663 A G 2: 165,359,075 V13A probably damaging Het
Other mutations in Olfr661
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Olfr661 APN 7 104688381 missense probably benign 0.00
IGL01578:Olfr661 APN 7 104688845 missense probably benign 0.01
IGL01595:Olfr661 APN 7 104688078 missense possibly damaging 0.78
IGL01732:Olfr661 APN 7 104688336 missense possibly damaging 0.64
IGL02086:Olfr661 APN 7 104688427 missense probably benign 0.38
IGL02421:Olfr661 APN 7 104688533 missense probably benign 0.00
IGL02874:Olfr661 APN 7 104688023 missense probably benign 0.16
IGL03120:Olfr661 APN 7 104688402 missense probably benign 0.28
R1246:Olfr661 UTSW 7 104688164 missense possibly damaging 0.69
R1654:Olfr661 UTSW 7 104688213 missense probably benign 0.12
R1994:Olfr661 UTSW 7 104688483 missense probably benign 0.12
R3686:Olfr661 UTSW 7 104688392 missense probably benign 0.00
R5140:Olfr661 UTSW 7 104688900 missense probably benign 0.01
R5627:Olfr661 UTSW 7 104688170 missense probably benign 0.02
R6338:Olfr661 UTSW 7 104688171 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GCCATCAGAAATTTTGTGGCTCCC -3'
(R):5'- TTTGACATCCAGCCTGAGCACC -3'

Sequencing Primer
(F):5'- CTTGCCTGTGATGACAGGAAAATC -3'
(R):5'- ACATTGTGCAGCACGTTCAG -3'
Posted On2013-09-03