Incidental Mutation 'R0131:9530053A07Rik'
ID68289
Institutional Source Beutler Lab
Gene Symbol 9530053A07Rik
Ensembl Gene ENSMUSG00000078776
Gene NameRIKEN cDNA 9530053A07 gene
Synonyms
MMRRC Submission 038416-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R0131 (G1)
Quality Score162
Status Validated
Chromosome7
Chromosomal Location28129466-28164811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28137615 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 320 (R320G)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
Predicted Effect probably damaging
Transcript: ENSMUST00000059886
AA Change: R320G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: R320G

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130693
Predicted Effect probably damaging
Transcript: ENSMUST00000150948
AA Change: R320G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: R320G

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Meta Mutation Damage Score 0.276 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Dazap1 T G 10: 80,278,226 probably null Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Fat2 A T 11: 55,273,211 S3073T probably benign Het
Gm16069 T C 3: 89,180,925 probably benign Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kif3a A G 11: 53,586,916 K404R possibly damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr1037 T C 2: 86,085,500 I92M probably damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Pkp2 T C 16: 16,240,713 probably benign Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tbc1d9b T C 11: 50,135,924 I73T probably benign Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc3 T C 10: 94,545,575 probably benign Het
Tmem116 A G 5: 121,493,782 probably benign Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Tusc1 A T 4: 93,334,833 H196Q probably benign Het
Ugt2a1 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Zfp879 C A 11: 50,833,599 G210V probably damaging Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in 9530053A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:9530053A07Rik APN 7 28164528 missense probably damaging 1.00
IGL00757:9530053A07Rik APN 7 28154445 missense probably damaging 1.00
IGL01015:9530053A07Rik APN 7 28155318 missense probably damaging 1.00
IGL01079:9530053A07Rik APN 7 28139778 missense probably damaging 0.99
IGL01343:9530053A07Rik APN 7 28150702 missense probably benign 0.19
IGL01420:9530053A07Rik APN 7 28140133 missense probably benign 0.28
IGL01604:9530053A07Rik APN 7 28155324 missense probably benign 0.11
IGL01666:9530053A07Rik APN 7 28153292 missense probably damaging 1.00
IGL02002:9530053A07Rik APN 7 28152796 missense probably damaging 1.00
IGL02036:9530053A07Rik APN 7 28137525 missense possibly damaging 0.82
IGL02126:9530053A07Rik APN 7 28139856 missense probably damaging 1.00
IGL02150:9530053A07Rik APN 7 28146779 nonsense probably null
IGL02219:9530053A07Rik APN 7 28154635 missense probably damaging 1.00
IGL02563:9530053A07Rik APN 7 28157892 missense probably benign
IGL02804:9530053A07Rik APN 7 28153370 missense probably benign 0.00
IGL02830:9530053A07Rik APN 7 28162923 missense probably damaging 1.00
IGL02943:9530053A07Rik APN 7 28147188 missense probably damaging 1.00
IGL02977:9530053A07Rik APN 7 28164372 missense possibly damaging 0.83
IGL03231:9530053A07Rik APN 7 28153722 missense possibly damaging 0.95
IGL03304:9530053A07Rik APN 7 28142242 missense probably damaging 0.99
PIT4378001:9530053A07Rik UTSW 7 28154464 missense possibly damaging 0.61
R0023:9530053A07Rik UTSW 7 28153412 missense probably benign 0.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0132:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0158:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R0230:9530053A07Rik UTSW 7 28156825 missense probably damaging 1.00
R0310:9530053A07Rik UTSW 7 28142274 missense probably benign 0.04
R0448:9530053A07Rik UTSW 7 28140235 missense probably benign 0.03
R0462:9530053A07Rik UTSW 7 28137340 missense probably damaging 1.00
R0481:9530053A07Rik UTSW 7 28153749 missense probably damaging 1.00
R0497:9530053A07Rik UTSW 7 28147465 missense probably damaging 1.00
R0556:9530053A07Rik UTSW 7 28159378 missense probably benign
R0562:9530053A07Rik UTSW 7 28162690 missense probably benign 0.30
R0586:9530053A07Rik UTSW 7 28137091 missense probably damaging 0.99
R0924:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R0930:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R1103:9530053A07Rik UTSW 7 28154520 missense probably damaging 1.00
R1213:9530053A07Rik UTSW 7 28157673 missense probably damaging 1.00
R1292:9530053A07Rik UTSW 7 28142794 splice site probably benign
R1368:9530053A07Rik UTSW 7 28159478 missense possibly damaging 0.89
R1451:9530053A07Rik UTSW 7 28137157 missense probably damaging 1.00
R1477:9530053A07Rik UTSW 7 28157093 missense probably benign 0.01
R1538:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R1655:9530053A07Rik UTSW 7 28147110 missense probably damaging 0.98
R1697:9530053A07Rik UTSW 7 28154347 missense probably damaging 1.00
R1741:9530053A07Rik UTSW 7 28157854 missense probably damaging 0.98
R1796:9530053A07Rik UTSW 7 28155372 missense probably damaging 1.00
R1853:9530053A07Rik UTSW 7 28155546 nonsense probably null
R1861:9530053A07Rik UTSW 7 28154732 missense probably damaging 1.00
R1909:9530053A07Rik UTSW 7 28144348 missense possibly damaging 0.52
R1971:9530053A07Rik UTSW 7 28131512 missense possibly damaging 0.90
R1990:9530053A07Rik UTSW 7 28154360 missense probably damaging 0.98
R2020:9530053A07Rik UTSW 7 28155594 missense probably benign
R2084:9530053A07Rik UTSW 7 28157535 missense probably damaging 1.00
R2125:9530053A07Rik UTSW 7 28158022 missense probably benign 0.00
R2132:9530053A07Rik UTSW 7 28155474 missense probably damaging 1.00
R2513:9530053A07Rik UTSW 7 28131635 missense probably damaging 0.99
R2913:9530053A07Rik UTSW 7 28164307 missense probably damaging 1.00
R3150:9530053A07Rik UTSW 7 28154195 missense probably benign 0.21
R3499:9530053A07Rik UTSW 7 28154555 missense probably benign 0.42
R3702:9530053A07Rik UTSW 7 28157778 missense probably damaging 1.00
R3881:9530053A07Rik UTSW 7 28140038 nonsense probably null
R3938:9530053A07Rik UTSW 7 28154294 missense probably damaging 1.00
R4050:9530053A07Rik UTSW 7 28152985 missense possibly damaging 0.55
R4152:9530053A07Rik UTSW 7 28156897 missense possibly damaging 0.47
R4168:9530053A07Rik UTSW 7 28137109 missense probably benign 0.05
R4235:9530053A07Rik UTSW 7 28156648 missense probably damaging 0.99
R4241:9530053A07Rik UTSW 7 28154335 missense probably damaging 1.00
R4363:9530053A07Rik UTSW 7 28146906 missense probably damaging 1.00
R4460:9530053A07Rik UTSW 7 28152856 missense probably benign 0.17
R4463:9530053A07Rik UTSW 7 28150719 missense probably benign
R4841:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4842:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4876:9530053A07Rik UTSW 7 28142800 intron probably benign
R4905:9530053A07Rik UTSW 7 28156983 missense possibly damaging 0.93
R4997:9530053A07Rik UTSW 7 28143924 missense possibly damaging 0.77
R5091:9530053A07Rik UTSW 7 28156958 missense probably benign 0.44
R5159:9530053A07Rik UTSW 7 28153308 missense probably benign 0.09
R5326:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5396:9530053A07Rik UTSW 7 28140183 missense probably benign
R5441:9530053A07Rik UTSW 7 28156914 missense probably damaging 1.00
R5480:9530053A07Rik UTSW 7 28157999 nonsense probably null
R5542:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5571:9530053A07Rik UTSW 7 28156569 missense probably damaging 0.99
R5613:9530053A07Rik UTSW 7 28142878 intron probably benign
R5637:9530053A07Rik UTSW 7 28152852 missense probably benign 0.00
R5766:9530053A07Rik UTSW 7 28137329 nonsense probably null
R6174:9530053A07Rik UTSW 7 28139959 missense probably damaging 0.96
R6233:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R6250:9530053A07Rik UTSW 7 28150714 missense probably damaging 1.00
R6379:9530053A07Rik UTSW 7 28157592 missense probably damaging 1.00
R6442:9530053A07Rik UTSW 7 28144186 missense possibly damaging 0.88
R6478:9530053A07Rik UTSW 7 28155373 missense probably damaging 1.00
R6699:9530053A07Rik UTSW 7 28144368 missense probably damaging 1.00
R6852:9530053A07Rik UTSW 7 28147135 missense probably damaging 1.00
R6883:9530053A07Rik UTSW 7 28152835 missense possibly damaging 0.89
R6902:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6903:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6904:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6992:9530053A07Rik UTSW 7 28140183 missense probably benign 0.04
R7023:9530053A07Rik UTSW 7 28140038 nonsense probably null
R7039:9530053A07Rik UTSW 7 28140148 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCAGGCCCAGCTCTTTAAGAAAGAC -3'
(R):5'- TCTTGTGGCAACCTCAATCACTGTG -3'

Sequencing Primer
(F):5'- CTTTAAGAAAGACCTTTTCTGTGGC -3'
(R):5'- AACCTCAATCACTGTGGTCTATC -3'
Posted On2013-09-03