Incidental Mutation 'R0131:Ascc3'
ID68296
Institutional Source Beutler Lab
Gene Symbol Ascc3
Ensembl Gene ENSMUSG00000038774
Gene Nameactivating signal cointegrator 1 complex subunit 3
SynonymsB630009I04Rik, ASC1p200, Helic1
MMRRC Submission 038416-MU
Accession Numbers

Ncbi RefSeq: NM_198007.2; MGI:1925237

Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R0131 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location50592669-50851485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 50735329 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 1589 (W1589G)
Ref Sequence ENSEMBL: ENSMUSP00000036726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035606]
Predicted Effect probably damaging
Transcript: ENSMUST00000035606
AA Change: W1589G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036726
Gene: ENSMUSG00000038774
AA Change: W1589G

DomainStartEndE-ValueType
coiled coil region 55 79 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 329 356 N/A INTRINSIC
DEXDc 474 686 1.71e-29 SMART
AAA 492 674 8.15e-2 SMART
Blast:DEXDc 718 763 4e-18 BLAST
HELICc 770 858 6.01e-16 SMART
Sec63 979 1288 3.53e-111 SMART
DEXDc 1324 1528 8.88e-28 SMART
AAA 1342 1492 4.27e-1 SMART
HELICc 1605 1695 2.28e-16 SMART
Sec63 1813 2178 6.37e-118 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219085
Meta Mutation Damage Score 0.436 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of helicases that are involved in the ATP-dependent unwinding of nucleic acid duplexes. The encoded protein is the largest subunit of the activating signal cointegrator 1 complex that is involved in DNA repair and resistance to alkylation damage. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Dazap1 T G 10: 80,278,226 probably null Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Fat2 A T 11: 55,273,211 S3073T probably benign Het
Gm16069 T C 3: 89,180,925 probably benign Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kif3a A G 11: 53,586,916 K404R possibly damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr1037 T C 2: 86,085,500 I92M probably damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Pkp2 T C 16: 16,240,713 probably benign Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tbc1d9b T C 11: 50,135,924 I73T probably benign Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc3 T C 10: 94,545,575 probably benign Het
Tmem116 A G 5: 121,493,782 probably benign Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Tusc1 A T 4: 93,334,833 H196Q probably benign Het
Ugt2a1 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Zfp879 C A 11: 50,833,599 G210V probably damaging Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Ascc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ascc3 APN 10 50714435 missense probably damaging 0.99
IGL00690:Ascc3 APN 10 50699943 nonsense probably null
IGL00897:Ascc3 APN 10 50728091 missense probably benign 0.01
IGL01077:Ascc3 APN 10 50649317 splice site probably benign
IGL01124:Ascc3 APN 10 50732473 missense probably damaging 1.00
IGL01555:Ascc3 APN 10 50750522 missense probably damaging 1.00
IGL02019:Ascc3 APN 10 50690139 missense probably damaging 1.00
IGL02161:Ascc3 APN 10 50850527 nonsense probably null
IGL02247:Ascc3 APN 10 50650590 missense probably damaging 1.00
IGL02318:Ascc3 APN 10 50728154 nonsense probably null
IGL02428:Ascc3 APN 10 50845695 nonsense probably null
IGL02432:Ascc3 APN 10 50700493 missense probably damaging 0.99
IGL02449:Ascc3 APN 10 50700599 missense probably benign 0.00
IGL02640:Ascc3 APN 10 50767374 missense possibly damaging 0.69
IGL02673:Ascc3 APN 10 50660673 missense probably benign 0.01
IGL03144:Ascc3 APN 10 50767443 missense probably benign 0.16
IGL03161:Ascc3 APN 10 50618072 missense probably damaging 0.98
IGL03218:Ascc3 APN 10 50823853 missense possibly damaging 0.89
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0132:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0149:Ascc3 UTSW 10 50607993 missense probably benign 0.31
R0165:Ascc3 UTSW 10 50842127 intron probably null
R0255:Ascc3 UTSW 10 50645058 missense probably benign 0.00
R0310:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0314:Ascc3 UTSW 10 50637999 missense possibly damaging 0.92
R0362:Ascc3 UTSW 10 50748955 splice site probably benign
R0418:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0419:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0421:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0480:Ascc3 UTSW 10 50735252 missense probably damaging 1.00
R0744:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R0833:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R1231:Ascc3 UTSW 10 50823660 missense probably damaging 1.00
R1264:Ascc3 UTSW 10 50642519 splice site probably benign
R1302:Ascc3 UTSW 10 50604794 start codon destroyed probably null 1.00
R1751:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1767:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1769:Ascc3 UTSW 10 50700490 missense probably damaging 1.00
R1840:Ascc3 UTSW 10 50690161 missense probably benign 0.00
R1855:Ascc3 UTSW 10 50617922 missense probably benign 0.01
R1953:Ascc3 UTSW 10 50845630 missense probably benign
R1976:Ascc3 UTSW 10 50649166 missense probably damaging 1.00
R2004:Ascc3 UTSW 10 50617742 missense probably damaging 1.00
R2013:Ascc3 UTSW 10 50649812 missense probably damaging 0.99
R2017:Ascc3 UTSW 10 50690211 missense probably benign 0.00
R2040:Ascc3 UTSW 10 50728131 missense probably benign
R2043:Ascc3 UTSW 10 50700520 missense probably damaging 1.00
R2165:Ascc3 UTSW 10 50721839 missense probably damaging 1.00
R2226:Ascc3 UTSW 10 50754052 missense probably benign 0.07
R2310:Ascc3 UTSW 10 50748892 missense probably benign 0.15
R2405:Ascc3 UTSW 10 50731678 missense probably damaging 1.00
R2424:Ascc3 UTSW 10 50618201 missense probably benign 0.14
R3410:Ascc3 UTSW 10 50700100 missense probably damaging 1.00
R3617:Ascc3 UTSW 10 50618185 missense probably benign 0.00
R3771:Ascc3 UTSW 10 50720718 splice site probably benign
R3783:Ascc3 UTSW 10 50728254 missense probably damaging 1.00
R3891:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R3892:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R4435:Ascc3 UTSW 10 50721885 missense probably benign 0.14
R4509:Ascc3 UTSW 10 50842243 missense probably benign 0.00
R4520:Ascc3 UTSW 10 50660670 missense probably benign
R4521:Ascc3 UTSW 10 50660670 missense probably benign
R4522:Ascc3 UTSW 10 50660670 missense probably benign
R4524:Ascc3 UTSW 10 50660670 missense probably benign
R4581:Ascc3 UTSW 10 50711025 missense probably damaging 1.00
R4701:Ascc3 UTSW 10 50720664 missense possibly damaging 0.66
R4704:Ascc3 UTSW 10 50659014 missense probably benign 0.02
R4768:Ascc3 UTSW 10 50700499 missense probably damaging 1.00
R4823:Ascc3 UTSW 10 50713233 missense probably damaging 1.00
R4906:Ascc3 UTSW 10 50749131 missense probably damaging 1.00
R4937:Ascc3 UTSW 10 50823798 missense probably damaging 1.00
R5001:Ascc3 UTSW 10 50823648 missense probably damaging 1.00
R5151:Ascc3 UTSW 10 50637963 missense probably damaging 0.99
R5263:Ascc3 UTSW 10 50716661 missense probably benign 0.00
R5302:Ascc3 UTSW 10 50707777 missense probably benign 0.09
R5436:Ascc3 UTSW 10 50658983 missense probably damaging 0.99
R5455:Ascc3 UTSW 10 50849583 missense probably benign 0.06
R5474:Ascc3 UTSW 10 50849538 missense probably benign 0.25
R5744:Ascc3 UTSW 10 50710881 missense probably benign
R5781:Ascc3 UTSW 10 50637978 missense probably damaging 1.00
R5850:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R5867:Ascc3 UTSW 10 50842183 nonsense probably null
R5868:Ascc3 UTSW 10 50842183 nonsense probably null
R5869:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6109:Ascc3 UTSW 10 50649247 missense probably benign 0.37
R6122:Ascc3 UTSW 10 50617925 missense probably benign
R6128:Ascc3 UTSW 10 50650638 missense probably damaging 1.00
R6351:Ascc3 UTSW 10 50720673 missense probably damaging 0.99
R6368:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6369:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6409:Ascc3 UTSW 10 50845580 missense probably benign 0.09
R6472:Ascc3 UTSW 10 50720687 missense probably benign 0.03
R6474:Ascc3 UTSW 10 50748836 missense probably benign 0.01
R6480:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R6553:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6572:Ascc3 UTSW 10 50690247 nonsense probably null
R6585:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6656:Ascc3 UTSW 10 50649925 nonsense probably null
R6669:Ascc3 UTSW 10 50840373 missense probably benign
R6675:Ascc3 UTSW 10 50750563 nonsense probably null
R6790:Ascc3 UTSW 10 50645712 missense probably damaging 1.00
R6856:Ascc3 UTSW 10 50749062 missense probably damaging 1.00
R6862:Ascc3 UTSW 10 50849646 missense probably null 0.51
R6919:Ascc3 UTSW 10 50645753 nonsense probably null
R6936:Ascc3 UTSW 10 50729961 missense probably damaging 0.98
R6953:Ascc3 UTSW 10 50645666 missense probably benign 0.00
R6957:Ascc3 UTSW 10 50728182 missense probably damaging 1.00
R7022:Ascc3 UTSW 10 50716629 missense possibly damaging 0.55
R7050:Ascc3 UTSW 10 50840350 missense probably benign 0.43
X0021:Ascc3 UTSW 10 50700590 missense possibly damaging 0.88
X0025:Ascc3 UTSW 10 50650596 missense probably benign 0.00
X0026:Ascc3 UTSW 10 50732478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTCCCACTTGAAGCCACAGATATG -3'
(R):5'- TGTATGACAGTAGCACAATGGACTCCT -3'

Sequencing Primer
(F):5'- TCATGGAACTCTTAGATCCCAGG -3'
(R):5'- AGCACAATGGACTCCTTGTTCC -3'
Posted On2013-09-03