Incidental Mutation 'V7580:Lrp4'
ID69396
Institutional Source Beutler Lab
Gene Symbol Lrp4
Ensembl Gene ENSMUSG00000027253
Gene Namelow density lipoprotein receptor-related protein 4
Synonymsmdig, Megf7
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.620) question?
Stock #V7580 () of strain stinger
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91457511-91513779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91488518 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 900 (S900L)
Ref Sequence ENSEMBL: ENSMUSP00000028689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028689
AA Change: S900L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028689
Gene: ENSMUSG00000027253
AA Change: S900L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LDLa 26 68 5.77e-10 SMART
LDLa 70 107 4.05e-14 SMART
LDLa 109 145 1.9e-10 SMART
LDLa 147 184 1.51e-13 SMART
LDLa 190 227 6.83e-12 SMART
LDLa 230 267 2.45e-13 SMART
LDLa 269 306 6.32e-16 SMART
LDLa 311 351 3.24e-13 SMART
EGF 357 394 1.4e0 SMART
EGF_CA 395 434 1.05e-8 SMART
LY 460 502 7.01e-10 SMART
LY 503 545 4.41e-16 SMART
LY 546 589 1.04e-12 SMART
LY 590 632 5.07e-16 SMART
LY 633 674 3.12e-7 SMART
EGF 701 737 9.27e-1 SMART
LY 765 807 7.29e-8 SMART
LY 808 850 1.92e-16 SMART
LY 851 894 3.05e-10 SMART
LY 895 937 6.69e-16 SMART
LY 938 979 8.71e-6 SMART
EGF 1005 1044 1.64e-1 SMART
LY 1073 1115 2.58e-8 SMART
LY 1116 1158 1.57e-12 SMART
LY 1159 1202 7.4e-9 SMART
LY 1203 1245 9.39e-11 SMART
LY 1246 1285 6.11e-1 SMART
EGF 1312 1349 1.53e-1 SMART
LY 1377 1419 4.42e-7 SMART
LY 1420 1462 1.04e-12 SMART
LY 1463 1506 2.11e-13 SMART
LY 1507 1549 4.66e-15 SMART
LY 1550 1590 2.02e-1 SMART
EGF_like 1616 1649 5.79e1 SMART
low complexity region 1674 1690 N/A INTRINSIC
transmembrane domain 1724 1746 N/A INTRINSIC
low complexity region 1857 1870 N/A INTRINSIC
Meta Mutation Damage Score 0.0572 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor-related protein family. The encoded protein may be a regulator of Wnt signaling. Mutations in this gene are associated with Cenani-Lenz syndrome. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations of this gene cause polysyndactyly. Additional phenotypes may include growth retardation, abnormal incisor development, kidney agenesis, and neonatal lethality associated with respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,886,179 M950L probably benign Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Casp8ap2 C T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 17,820,528 probably null Het
Cfi T A 3: 129,854,992 I175K possibly damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrrc37a T G 11: 103,455,512 N3176T possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Mylk G T 16: 34,995,204 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr1440 G A 19: 12,394,550 V96I probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Sptbn2 C T 19: 4,750,632 R2292C probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Lrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Lrp4 APN 2 91495026 missense probably benign
IGL00509:Lrp4 APN 2 91486174 splice site probably benign
IGL01145:Lrp4 APN 2 91487051 missense probably damaging 1.00
IGL01287:Lrp4 APN 2 91473948 missense probably damaging 1.00
IGL01531:Lrp4 APN 2 91511553 missense probably damaging 1.00
IGL01534:Lrp4 APN 2 91473641 missense probably damaging 1.00
IGL01544:Lrp4 APN 2 91477551 missense probably damaging 1.00
IGL01761:Lrp4 APN 2 91481981 critical splice donor site probably null
IGL01885:Lrp4 APN 2 91501107 missense probably benign 0.05
IGL01909:Lrp4 APN 2 91494184 missense possibly damaging 0.50
IGL02111:Lrp4 APN 2 91506059 missense probably damaging 1.00
IGL02385:Lrp4 APN 2 91474720 missense possibly damaging 0.89
IGL02403:Lrp4 APN 2 91508582 missense probably benign 0.05
IGL02431:Lrp4 APN 2 91476637 missense possibly damaging 0.95
IGL02452:Lrp4 APN 2 91474002 missense probably damaging 1.00
IGL02798:Lrp4 APN 2 91476710 missense probably benign 0.02
IGL02828:Lrp4 APN 2 91475294 missense probably benign
IGL02832:Lrp4 APN 2 91511580 missense probably damaging 1.00
IGL02893:Lrp4 APN 2 91474816 missense possibly damaging 0.76
F5770:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
R0037:Lrp4 UTSW 2 91471203 missense probably benign 0.22
R0037:Lrp4 UTSW 2 91471203 missense probably benign 0.22
R0137:Lrp4 UTSW 2 91494982 missense probably damaging 1.00
R0265:Lrp4 UTSW 2 91490670 missense probably damaging 1.00
R0368:Lrp4 UTSW 2 91477734 missense probably damaging 0.99
R0531:Lrp4 UTSW 2 91475178 splice site probably benign
R0827:Lrp4 UTSW 2 91495041 missense probably damaging 1.00
R1029:Lrp4 UTSW 2 91487027 splice site probably benign
R1183:Lrp4 UTSW 2 91477519 critical splice acceptor site probably null
R1587:Lrp4 UTSW 2 91476305 missense probably benign 0.26
R1693:Lrp4 UTSW 2 91492353 missense probably damaging 1.00
R1747:Lrp4 UTSW 2 91492621 missense probably damaging 0.98
R1863:Lrp4 UTSW 2 91498363 missense probably benign 0.15
R1908:Lrp4 UTSW 2 91498408 missense possibly damaging 0.93
R1909:Lrp4 UTSW 2 91498408 missense possibly damaging 0.93
R1932:Lrp4 UTSW 2 91497355 nonsense probably null
R1934:Lrp4 UTSW 2 91480432 missense probably damaging 1.00
R2358:Lrp4 UTSW 2 91501954 missense probably benign 0.01
R2433:Lrp4 UTSW 2 91506015 missense probably benign 0.00
R2698:Lrp4 UTSW 2 91475212 missense probably damaging 0.99
R2919:Lrp4 UTSW 2 91490730 missense probably benign 0.01
R3105:Lrp4 UTSW 2 91501049 missense probably benign
R3709:Lrp4 UTSW 2 91490466 missense possibly damaging 0.60
R3711:Lrp4 UTSW 2 91501954 missense probably benign 0.01
R3735:Lrp4 UTSW 2 91498371 missense probably damaging 1.00
R3808:Lrp4 UTSW 2 91476702 missense probably damaging 0.99
R3894:Lrp4 UTSW 2 91473949 missense probably damaging 1.00
R3895:Lrp4 UTSW 2 91473949 missense probably damaging 1.00
R4397:Lrp4 UTSW 2 91511670 missense probably benign 0.20
R4741:Lrp4 UTSW 2 91511567 missense probably damaging 1.00
R4948:Lrp4 UTSW 2 91485886 missense probably benign
R5050:Lrp4 UTSW 2 91492422 missense probably benign 0.22
R5096:Lrp4 UTSW 2 91485792 missense possibly damaging 0.65
R5110:Lrp4 UTSW 2 91497072 missense possibly damaging 0.48
R5141:Lrp4 UTSW 2 91478678 splice site probably benign
R5439:Lrp4 UTSW 2 91497073 missense probably benign 0.14
R5725:Lrp4 UTSW 2 91494895 missense probably damaging 1.00
R5795:Lrp4 UTSW 2 91474471 missense probably benign 0.01
R5820:Lrp4 UTSW 2 91492615 missense probably damaging 0.99
R5883:Lrp4 UTSW 2 91488433 missense probably benign 0.01
R5919:Lrp4 UTSW 2 91473207 missense probably damaging 1.00
R5925:Lrp4 UTSW 2 91511684 missense probably benign 0.01
R6080:Lrp4 UTSW 2 91502000 missense probably benign
R6189:Lrp4 UTSW 2 91475234 missense possibly damaging 0.63
R6192:Lrp4 UTSW 2 91508488 missense probably benign 0.00
R6319:Lrp4 UTSW 2 91480321 missense probably damaging 1.00
R6378:Lrp4 UTSW 2 91493829 missense probably benign 0.18
R6479:Lrp4 UTSW 2 91487084 missense probably damaging 0.96
R6500:Lrp4 UTSW 2 91492420 missense possibly damaging 0.90
R6643:Lrp4 UTSW 2 91501995 missense probably benign
R6657:Lrp4 UTSW 2 91492053 missense probably benign 0.00
R6696:Lrp4 UTSW 2 91497345 missense probably benign 0.03
R6714:Lrp4 UTSW 2 91476365 missense possibly damaging 0.90
R6734:Lrp4 UTSW 2 91485897 missense possibly damaging 0.79
R6770:Lrp4 UTSW 2 91497303 missense probably benign 0.33
R6774:Lrp4 UTSW 2 91511504 missense probably benign 0.01
R6957:Lrp4 UTSW 2 91487042 missense probably damaging 0.99
R6978:Lrp4 UTSW 2 91491998 missense probably damaging 1.00
V7581:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7582:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
V7583:Lrp4 UTSW 2 91488518 missense possibly damaging 0.96
X0021:Lrp4 UTSW 2 91501062 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AAAGCCTTTGAGGACCCTGCAC -3'
(R):5'- TTGAATCGTCAACCAGCAGCCC -3'

Sequencing Primer
(F):5'- GGACCCTGCACCCTCATC -3'
(R):5'- TGGAGCTACAGTCTTAGACAAAC -3'
Posted On2013-09-04