Incidental Mutation 'V7580:Cfi'
ID69403
Institutional Source Beutler Lab
Gene Symbol Cfi
Ensembl Gene ENSMUSG00000058952
Gene Namecomplement component factor i
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #V7580 () of strain stinger
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location129835884-129875332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129854992 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 175 (I175K)
Ref Sequence ENSEMBL: ENSMUSP00000077074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077918] [ENSMUST00000200206]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077918
AA Change: I175K

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077074
Gene: ENSMUSG00000058952
AA Change: I175K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 4.63e-38 SMART
KAZAL 63 109 6.91e-3 SMART
SR 117 220 2.95e-22 SMART
LDLa 225 262 1.07e-4 SMART
LDLa 263 300 7.16e-6 SMART
low complexity region 317 326 N/A INTRINSIC
Tryp_SPc 360 589 3.33e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200206
SMART Domains Protein: ENSMUSP00000142975
Gene: ENSMUSG00000058952

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FIMAC 45 111 2.2e-40 SMART
KAZAL 63 109 4.4e-5 SMART
Blast:SR 117 145 3e-11 BLAST
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine protease that plays an important role in the classical and alternative complement pathways where it cleaves C4b and C3b components of C3 and C5 convertases. The encoded preproprotein undergoes proteolytic processing to generate an active, disulfide-linked heterodimeric enzyme comprised of heavy and light chains. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice display uncontrolled alternative pathway activation as shown by reduced complement C3, factor B, and factor H levels, but do not develop C3 deposition along the glomerular basement membrane or membranoproliferative glomerulonephritistype II. Plasma C3 circulates as C3b. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,886,179 M950L probably benign Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Casp8ap2 C T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 17,820,528 probably null Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Lrrc37a T G 11: 103,455,512 N3176T possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Mylk G T 16: 34,995,204 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr1440 G A 19: 12,394,550 V96I probably benign Het
Otop3 T A 11: 115,344,838 L451Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Slc30a4 T A 2: 122,689,538 M185L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Sptbn2 C T 19: 4,750,632 R2292C probably damaging Het
Tnrc6c G A 11: 117,723,326 R930H probably damaging Het
Trps1 T C 15: 50,831,577 K441E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zmynd8 G A 2: 165,812,394 R749* probably null Het
Other mutations in Cfi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Cfi APN 3 129873095 missense probably damaging 0.97
IGL00659:Cfi APN 3 129836813 missense unknown
IGL01310:Cfi APN 3 129858431 missense probably damaging 1.00
IGL01387:Cfi APN 3 129874913 unclassified probably benign
IGL01897:Cfi APN 3 129858385 missense probably damaging 1.00
IGL02418:Cfi APN 3 129848812 missense probably benign 0.20
F5770:Cfi UTSW 3 129854992 missense possibly damaging 0.62
R0085:Cfi UTSW 3 129874986 missense probably benign 0.00
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0102:Cfi UTSW 3 129848767 missense probably damaging 0.97
R0835:Cfi UTSW 3 129868542 missense probably damaging 1.00
R1191:Cfi UTSW 3 129868527 missense probably benign 0.01
R1221:Cfi UTSW 3 129872969 missense probably damaging 0.99
R1576:Cfi UTSW 3 129873050 missense probably damaging 0.98
R1809:Cfi UTSW 3 129873119 critical splice donor site probably null
R1940:Cfi UTSW 3 129858828 splice site probably benign
R1983:Cfi UTSW 3 129868545 missense probably damaging 1.00
R2069:Cfi UTSW 3 129858804 synonymous probably null
R3012:Cfi UTSW 3 129874930 missense probably damaging 1.00
R4334:Cfi UTSW 3 129850829 missense possibly damaging 0.80
R4596:Cfi UTSW 3 129868500 missense probably damaging 0.98
R4888:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5121:Cfi UTSW 3 129873077 missense probably damaging 1.00
R5322:Cfi UTSW 3 129873040 missense probably damaging 1.00
R5673:Cfi UTSW 3 129855009 missense probably benign 0.02
R6084:Cfi UTSW 3 129858370 missense probably benign 0.00
R6364:Cfi UTSW 3 129872846 missense probably benign 0.36
R6770:Cfi UTSW 3 129858730 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AGCGGTGTTTTCAACCCTACCTG -3'
(R):5'- GCATCCTGCTTGTAACACACTACCC -3'

Sequencing Primer
(F):5'- TTTCCAAAACCCCAGAGGTATTAAGG -3'
(R):5'- GTAACACACTACCCCCGCC -3'
Posted On2013-09-04