Mutagenetix > Incidental Mutations

Incidental Mutation 'V7580:Casp8ap2'

69404

Institutional Source

Beutler Lab

Gene Symbol

Casp8ap2

Ensembl Gene

ENSMUSG00000028282

Gene Name

caspase 8 associated protein 2

Synonyms

FLASH, D4Ertd659e

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

V7580 () of strain stinger

Quality Score

160

Status

Not validated

Chromosome

Chromosomal Location

32615451-32653265 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 32639944 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 333 (H333Y)

Ref Sequence

ENSEMBL: ENSMUSP00000136016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]

Predicted Effect

probably benign
Transcript: ENSMUST00000029950
AA Change: H333Y

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: H333Y

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000108178

SMART Domains

Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

Domain	Start	End	E-Value	Type
PDB:2LR8\|A	126	190	4e-26	PDB
Blast:SANT	139	183	4e-19	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127619

Predicted Effect

probably benign
Transcript: ENSMUST00000178925
AA Change: H333Y

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: H333Y

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Meta Mutation Damage Score

0.1308

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 97.8%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,886,179	M950L	probably benign	Het
Atp6v1h	A	G	1: 5,124,443	T282A	possibly damaging	Het
Cd36	ACTGTCTGT	ACTGT	5: 17,820,528		probably null	Het
Cfi	T	A	3: 129,854,992	I175K	possibly damaging	Het
D630003M21Rik	T	C	2: 158,201,011	T870A	probably benign	Het
Dnah12	T	A	14: 26,773,093	N1369K	possibly damaging	Het
Dnajc22	T	A	15: 99,101,482	Y183N	probably damaging	Het
Erv3	T	C	2: 131,855,926	H171R	possibly damaging	Het
Fam221b	T	C	4: 43,665,865	T249A	probably benign	Het
Gm10770	T	A	2: 150,179,484	K38*	probably null	Het
Gm4787	G	A	12: 81,377,567	Q606*	probably null	Het
Izumo4	A	T	10: 80,703,891	T155S	probably benign	Het
Kcnb2	A	G	1: 15,710,091	I396V	probably benign	Het
Klc1	A	T	12: 111,774,572	I161F	probably benign	Het
Lpar5	C	A	6: 125,081,727	A137E	possibly damaging	Het
Lrp4	C	T	2: 91,488,518	S900L	possibly damaging	Het
Lrrc37a	T	G	11: 103,455,512	N3176T	possibly damaging	Het
Med20	G	A	17: 47,618,832	V65M	probably damaging	Het
Mylk	G	T	16: 34,995,204		probably null	Het
Numbl	T	C	7: 27,279,602	S379P	probably benign	Het
Olfr1406	G	T	1: 173,183,964	L157I	probably benign	Het
Olfr1440	G	A	19: 12,394,550	V96I	probably benign	Het
Otop3	T	A	11: 115,344,838	L432Q	probably damaging	Het
Papln	C	T	12: 83,778,834	R608C	possibly damaging	Het
Pelp1	T	A	11: 70,398,150	T257S	probably damaging	Het
Pigx	T	C	16: 32,087,422	D129G	probably damaging	Het
Pik3cd	A	C	4: 149,657,319	L390R	probably damaging	Het
Plekhb1	T	C	7: 100,654,618	T112A	probably benign	Het
Ppwd1	A	G	13: 104,220,237	Y257H	probably damaging	Het
Recql4	T	C	15: 76,706,169	D705G	possibly damaging	Het
Ror1	A	G	4: 100,440,933	Q501R	probably damaging	Het
Slc30a4	T	A	2: 122,689,538	M136L	probably benign	Het
Spaca1	T	C	4: 34,039,311	E192G	probably damaging	Het
Spata31	C	A	13: 64,921,648	P537T	probably benign	Het
Sptbn2	C	T	19: 4,750,632	R2292C	probably damaging	Het
Tnrc6c	G	A	11: 117,723,326	R770H	probably damaging	Het
Trps1	T	C	15: 50,831,577	K150E	probably damaging	Het
Tspyl3	A	G	2: 153,225,060	V86A	probably benign	Het
Zfp292	C	T	4: 34,806,783	C2087Y	possibly damaging	Het
Zmynd8	G	A	2: 165,812,394	R724*	probably null	Het

Other mutations in Casp8ap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00686:Casp8ap2	APN	4	32641433	missense	probably damaging	1.00
IGL00714:Casp8ap2	APN	4	32649192	missense	probably damaging	1.00
IGL00754:Casp8ap2	APN	4	32641036	missense	probably benign	0.00
IGL00954:Casp8ap2	APN	4	32645403	missense	probably damaging	1.00
IGL00970:Casp8ap2	APN	4	32646182	missense	probably benign
IGL01534:Casp8ap2	APN	4	32648134	splice site	probably benign
IGL01596:Casp8ap2	APN	4	32646365	missense	probably damaging	1.00
IGL01686:Casp8ap2	APN	4	32641294	missense	possibly damaging	0.94
IGL02002:Casp8ap2	APN	4	32639391	missense	probably damaging	1.00
IGL02273:Casp8ap2	APN	4	32643974	missense	probably damaging	1.00
IGL02510:Casp8ap2	APN	4	32639704	missense	probably benign	0.05
IGL02600:Casp8ap2	APN	4	32630246	missense	probably null	1.00
IGL02929:Casp8ap2	APN	4	32624105	utr 5 prime	probably benign
F5770:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
IGL02988:Casp8ap2	UTSW	4	32644590	missense	probably benign	0.14
R0023:Casp8ap2	UTSW	4	32640185	missense	probably damaging	0.99
R0027:Casp8ap2	UTSW	4	32643810	missense	probably benign	0.01
R0090:Casp8ap2	UTSW	4	32640327	missense	probably damaging	1.00
R0117:Casp8ap2	UTSW	4	32640817	missense	probably benign	0.00
R0144:Casp8ap2	UTSW	4	32643797	missense	possibly damaging	0.50
R0268:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0344:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0555:Casp8ap2	UTSW	4	32640381	missense	probably damaging	1.00
R1051:Casp8ap2	UTSW	4	32640790	missense	probably benign	0.28
R1165:Casp8ap2	UTSW	4	32640563	missense	probably benign	0.01
R1243:Casp8ap2	UTSW	4	32645687	missense	probably benign	0.03
R1311:Casp8ap2	UTSW	4	32648111	missense	probably damaging	0.98
R1337:Casp8ap2	UTSW	4	32645721	missense	possibly damaging	0.64
R1471:Casp8ap2	UTSW	4	32639386	nonsense	probably null
R1497:Casp8ap2	UTSW	4	32639938	missense	probably benign	0.00
R1521:Casp8ap2	UTSW	4	32631867	missense	probably damaging	1.00
R1588:Casp8ap2	UTSW	4	32640541	missense	probably benign	0.00
R1625:Casp8ap2	UTSW	4	32648068	missense	probably benign	0.04
R1731:Casp8ap2	UTSW	4	32641442	missense	possibly damaging	0.94
R1899:Casp8ap2	UTSW	4	32643647	missense	probably damaging	0.98
R2000:Casp8ap2	UTSW	4	32634874	missense	probably damaging	1.00
R2021:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2022:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2023:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2088:Casp8ap2	UTSW	4	32631126	missense	probably damaging	1.00
R2104:Casp8ap2	UTSW	4	32644727	missense	probably benign	0.00
R2128:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2129:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2305:Casp8ap2	UTSW	4	32646411	missense	probably damaging	1.00
R2316:Casp8ap2	UTSW	4	32643781	missense	probably benign	0.31
R2919:Casp8ap2	UTSW	4	32645343	missense	probably damaging	1.00
R4091:Casp8ap2	UTSW	4	32643611	missense	probably damaging	1.00
R4357:Casp8ap2	UTSW	4	32646150	missense	probably benign	0.00
R4807:Casp8ap2	UTSW	4	32644505	missense	possibly damaging	0.89
R4828:Casp8ap2	UTSW	4	32639807	missense	probably benign
R4908:Casp8ap2	UTSW	4	32639905	missense	possibly damaging	0.90
R4945:Casp8ap2	UTSW	4	32631163	missense	possibly damaging	0.57
R4962:Casp8ap2	UTSW	4	32640554	missense	probably damaging	0.99
R6014:Casp8ap2	UTSW	4	32641400	missense	probably damaging	0.97
R6092:Casp8ap2	UTSW	4	32639380	missense	probably damaging	1.00
R6257:Casp8ap2	UTSW	4	32641364	missense	possibly damaging	0.94
R6289:Casp8ap2	UTSW	4	32639590	missense	probably damaging	1.00
R6482:Casp8ap2	UTSW	4	32634813	missense	probably damaging	1.00
R6496:Casp8ap2	UTSW	4	32641553	missense	probably benign	0.05
R6515:Casp8ap2	UTSW	4	32646423	missense	possibly damaging	0.64
X0018:Casp8ap2	UTSW	4	32643738	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGGCACTAGACATAGCCAGTGTAGC -3'
(R):5'- TGAAAGCCATGACTGTTCATCCCTC -3'

Sequencing Primer
(F):5'- AGCTGTAATGACAGTGAGCC -3'
(R):5'- GAAGCCGTAATGTTTCACGTC -3'

Posted On

2013-09-04