Incidental Mutation 'V7580:Casp8ap2'
ID 69404
Institutional Source Beutler Lab
Gene Symbol Casp8ap2
Ensembl Gene ENSMUSG00000028282
Gene Name caspase 8 associated protein 2
Synonyms FLASH, D4Ertd659e
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # V7580 () of strain stinger
Quality Score 160
Status Not validated
Chromosome 4
Chromosomal Location 32615462-32653271 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32639944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 333 (H333Y)
Ref Sequence ENSEMBL: ENSMUSP00000136016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]
AlphaFold Q9WUF3
Predicted Effect probably benign
Transcript: ENSMUST00000029950
AA Change: H333Y

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: H333Y

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108178
SMART Domains Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

DomainStartEndE-ValueType
PDB:2LR8|A 126 190 4e-26 PDB
Blast:SANT 139 183 4e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127619
Predicted Effect probably benign
Transcript: ENSMUST00000178925
AA Change: H333Y

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: H333Y

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,849,914 (GRCm39) M950L probably benign Het
Atp6v1h A G 1: 5,194,666 (GRCm39) T282A possibly damaging Het
Cd36 ACTGTCTGT ACTGT 5: 18,025,526 (GRCm39) probably null Het
Cfi T A 3: 129,648,641 (GRCm39) I175K possibly damaging Het
D630003M21Rik T C 2: 158,042,931 (GRCm39) T870A probably benign Het
Dnah12 T A 14: 26,495,050 (GRCm39) N1369K possibly damaging Het
Dnajc22 T A 15: 98,999,363 (GRCm39) Y183N probably damaging Het
Erv3 T C 2: 131,697,846 (GRCm39) H171R possibly damaging Het
Fam221b T C 4: 43,665,865 (GRCm39) T249A probably benign Het
Gm10770 T A 2: 150,021,404 (GRCm39) K38* probably null Het
Gm4787 G A 12: 81,424,341 (GRCm39) Q606* probably null Het
Izumo4 A T 10: 80,539,725 (GRCm39) T155S probably benign Het
Kcnb2 A G 1: 15,780,315 (GRCm39) I396V probably benign Het
Klc1 A T 12: 111,741,006 (GRCm39) I161F probably benign Het
Lpar5 C A 6: 125,058,690 (GRCm39) A137E possibly damaging Het
Lrp4 C T 2: 91,318,863 (GRCm39) S900L possibly damaging Het
Lrrc37a T G 11: 103,346,338 (GRCm39) N3176T possibly damaging Het
Med20 G A 17: 47,929,757 (GRCm39) V65M probably damaging Het
Mylk G T 16: 34,815,574 (GRCm39) probably null Het
Numbl T C 7: 26,979,027 (GRCm39) S379P probably benign Het
Or10j7 G T 1: 173,011,531 (GRCm39) L157I probably benign Het
Or5an6 G A 19: 12,371,914 (GRCm39) V96I probably benign Het
Otop3 T A 11: 115,235,664 (GRCm39) L432Q probably damaging Het
Papln C T 12: 83,825,608 (GRCm39) R608C possibly damaging Het
Pelp1 T A 11: 70,288,976 (GRCm39) T257S probably damaging Het
Pigx T C 16: 31,906,240 (GRCm39) D129G probably damaging Het
Pik3cd A C 4: 149,741,776 (GRCm39) L390R probably damaging Het
Plekhb1 T C 7: 100,303,825 (GRCm39) T112A probably benign Het
Ppwd1 A G 13: 104,356,745 (GRCm39) Y257H probably damaging Het
Recql4 T C 15: 76,590,369 (GRCm39) D705G possibly damaging Het
Ror1 A G 4: 100,298,130 (GRCm39) Q501R probably damaging Het
Slc30a4 T A 2: 122,531,458 (GRCm39) M136L probably benign Het
Spaca1 T C 4: 34,039,311 (GRCm39) E192G probably damaging Het
Spata31 C A 13: 65,069,462 (GRCm39) P537T probably benign Het
Sptbn2 C T 19: 4,800,660 (GRCm39) R2292C probably damaging Het
Tnrc6c G A 11: 117,614,152 (GRCm39) R770H probably damaging Het
Trps1 T C 15: 50,694,973 (GRCm39) K150E probably damaging Het
Tspyl3 A G 2: 153,066,980 (GRCm39) V86A probably benign Het
Zfp292 C T 4: 34,806,783 (GRCm39) C2087Y possibly damaging Het
Zmynd8 G A 2: 165,654,314 (GRCm39) R724* probably null Het
Other mutations in Casp8ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Casp8ap2 APN 4 32,641,433 (GRCm39) missense probably damaging 1.00
IGL00714:Casp8ap2 APN 4 32,649,192 (GRCm39) missense probably damaging 1.00
IGL00754:Casp8ap2 APN 4 32,641,036 (GRCm39) missense probably benign 0.00
IGL00954:Casp8ap2 APN 4 32,645,403 (GRCm39) missense probably damaging 1.00
IGL00970:Casp8ap2 APN 4 32,646,182 (GRCm39) missense probably benign
IGL01534:Casp8ap2 APN 4 32,648,134 (GRCm39) splice site probably benign
IGL01596:Casp8ap2 APN 4 32,646,365 (GRCm39) missense probably damaging 1.00
IGL01686:Casp8ap2 APN 4 32,641,294 (GRCm39) missense possibly damaging 0.94
IGL02002:Casp8ap2 APN 4 32,639,391 (GRCm39) missense probably damaging 1.00
IGL02273:Casp8ap2 APN 4 32,643,974 (GRCm39) missense probably damaging 1.00
IGL02510:Casp8ap2 APN 4 32,639,704 (GRCm39) missense probably benign 0.05
IGL02600:Casp8ap2 APN 4 32,630,246 (GRCm39) missense probably null 1.00
IGL02929:Casp8ap2 APN 4 32,624,105 (GRCm39) utr 5 prime probably benign
F5770:Casp8ap2 UTSW 4 32,639,944 (GRCm39) missense probably benign 0.00
IGL02988:Casp8ap2 UTSW 4 32,644,590 (GRCm39) missense probably benign 0.14
R0023:Casp8ap2 UTSW 4 32,640,185 (GRCm39) missense probably damaging 0.99
R0027:Casp8ap2 UTSW 4 32,643,810 (GRCm39) missense probably benign 0.01
R0090:Casp8ap2 UTSW 4 32,640,327 (GRCm39) missense probably damaging 1.00
R0117:Casp8ap2 UTSW 4 32,640,817 (GRCm39) missense probably benign 0.00
R0144:Casp8ap2 UTSW 4 32,643,797 (GRCm39) missense possibly damaging 0.50
R0268:Casp8ap2 UTSW 4 32,644,079 (GRCm39) missense probably damaging 0.99
R0344:Casp8ap2 UTSW 4 32,644,079 (GRCm39) missense probably damaging 0.99
R0555:Casp8ap2 UTSW 4 32,640,381 (GRCm39) missense probably damaging 1.00
R1051:Casp8ap2 UTSW 4 32,640,790 (GRCm39) missense probably benign 0.28
R1165:Casp8ap2 UTSW 4 32,640,563 (GRCm39) missense probably benign 0.01
R1243:Casp8ap2 UTSW 4 32,645,687 (GRCm39) missense probably benign 0.03
R1311:Casp8ap2 UTSW 4 32,648,111 (GRCm39) missense probably damaging 0.98
R1337:Casp8ap2 UTSW 4 32,645,721 (GRCm39) missense possibly damaging 0.64
R1471:Casp8ap2 UTSW 4 32,639,386 (GRCm39) nonsense probably null
R1497:Casp8ap2 UTSW 4 32,639,938 (GRCm39) missense probably benign 0.00
R1521:Casp8ap2 UTSW 4 32,631,867 (GRCm39) missense probably damaging 1.00
R1588:Casp8ap2 UTSW 4 32,640,541 (GRCm39) missense probably benign 0.00
R1625:Casp8ap2 UTSW 4 32,648,068 (GRCm39) missense probably benign 0.04
R1731:Casp8ap2 UTSW 4 32,641,442 (GRCm39) missense possibly damaging 0.94
R1899:Casp8ap2 UTSW 4 32,643,647 (GRCm39) missense probably damaging 0.98
R2000:Casp8ap2 UTSW 4 32,634,874 (GRCm39) missense probably damaging 1.00
R2021:Casp8ap2 UTSW 4 32,644,560 (GRCm39) missense probably benign 0.05
R2022:Casp8ap2 UTSW 4 32,644,560 (GRCm39) missense probably benign 0.05
R2023:Casp8ap2 UTSW 4 32,644,560 (GRCm39) missense probably benign 0.05
R2088:Casp8ap2 UTSW 4 32,631,126 (GRCm39) missense probably damaging 1.00
R2104:Casp8ap2 UTSW 4 32,644,727 (GRCm39) missense probably benign 0.00
R2128:Casp8ap2 UTSW 4 32,640,142 (GRCm39) missense probably benign 0.06
R2129:Casp8ap2 UTSW 4 32,640,142 (GRCm39) missense probably benign 0.06
R2305:Casp8ap2 UTSW 4 32,646,411 (GRCm39) missense probably damaging 1.00
R2316:Casp8ap2 UTSW 4 32,643,781 (GRCm39) missense probably benign 0.31
R2919:Casp8ap2 UTSW 4 32,645,343 (GRCm39) missense probably damaging 1.00
R4091:Casp8ap2 UTSW 4 32,643,611 (GRCm39) missense probably damaging 1.00
R4357:Casp8ap2 UTSW 4 32,646,150 (GRCm39) missense probably benign 0.00
R4807:Casp8ap2 UTSW 4 32,644,505 (GRCm39) missense possibly damaging 0.89
R4828:Casp8ap2 UTSW 4 32,639,807 (GRCm39) missense probably benign
R4908:Casp8ap2 UTSW 4 32,639,905 (GRCm39) missense possibly damaging 0.90
R4945:Casp8ap2 UTSW 4 32,631,163 (GRCm39) missense possibly damaging 0.57
R4962:Casp8ap2 UTSW 4 32,640,554 (GRCm39) missense probably damaging 0.99
R6014:Casp8ap2 UTSW 4 32,641,400 (GRCm39) missense probably damaging 0.97
R6092:Casp8ap2 UTSW 4 32,639,380 (GRCm39) missense probably damaging 1.00
R6257:Casp8ap2 UTSW 4 32,641,364 (GRCm39) missense possibly damaging 0.94
R6289:Casp8ap2 UTSW 4 32,639,590 (GRCm39) missense probably damaging 1.00
R6482:Casp8ap2 UTSW 4 32,634,813 (GRCm39) missense probably damaging 1.00
R6496:Casp8ap2 UTSW 4 32,641,553 (GRCm39) missense probably benign 0.05
R6515:Casp8ap2 UTSW 4 32,646,423 (GRCm39) missense possibly damaging 0.64
R7015:Casp8ap2 UTSW 4 32,644,278 (GRCm39) missense probably damaging 1.00
R7033:Casp8ap2 UTSW 4 32,639,392 (GRCm39) missense probably damaging 1.00
R7072:Casp8ap2 UTSW 4 32,644,766 (GRCm39) missense probably damaging 1.00
R7448:Casp8ap2 UTSW 4 32,643,974 (GRCm39) missense possibly damaging 0.84
R7944:Casp8ap2 UTSW 4 32,645,909 (GRCm39) missense probably benign 0.12
R7945:Casp8ap2 UTSW 4 32,645,909 (GRCm39) missense probably benign 0.12
R8170:Casp8ap2 UTSW 4 32,615,490 (GRCm39) splice site probably benign
R8179:Casp8ap2 UTSW 4 32,643,939 (GRCm39) nonsense probably null
R8207:Casp8ap2 UTSW 4 32,646,446 (GRCm39) missense possibly damaging 0.63
R8263:Casp8ap2 UTSW 4 32,644,072 (GRCm39) missense probably damaging 1.00
R8298:Casp8ap2 UTSW 4 32,640,429 (GRCm39) missense probably benign 0.30
R9441:Casp8ap2 UTSW 4 32,645,873 (GRCm39) missense probably benign 0.00
R9455:Casp8ap2 UTSW 4 32,643,924 (GRCm39) missense possibly damaging 0.85
R9729:Casp8ap2 UTSW 4 32,643,807 (GRCm39) missense possibly damaging 0.71
X0018:Casp8ap2 UTSW 4 32,643,738 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGCACTAGACATAGCCAGTGTAGC -3'
(R):5'- TGAAAGCCATGACTGTTCATCCCTC -3'

Sequencing Primer
(F):5'- AGCTGTAATGACAGTGAGCC -3'
(R):5'- GAAGCCGTAATGTTTCACGTC -3'
Posted On 2013-09-04