Incidental Mutation 'V7580:Spaca1'
ID69405
Institutional Source Beutler Lab
Gene Symbol Spaca1
Ensembl Gene ENSMUSG00000028264
Gene Namesperm acrosome associated 1
Synonyms1700124L11Rik, 4930540L03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #V7580 () of strain stinger
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location34024874-34050191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34039311 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 192 (E192G)
Ref Sequence ENSEMBL: ENSMUSP00000081785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029927] [ENSMUST00000084734] [ENSMUST00000108148]
Predicted Effect probably damaging
Transcript: ENSMUST00000029927
AA Change: E192G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029927
Gene: ENSMUSG00000028264
AA Change: E192G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084734
AA Change: E192G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081785
Gene: ENSMUSG00000028264
AA Change: E192G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108148
AA Change: E74G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103783
Gene: ENSMUSG00000028264
AA Change: E74G

DomainStartEndE-ValueType
transmembrane domain 109 131 N/A INTRINSIC
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from infertile males. Furthermore, antibodies generated against the recombinant protein block in vitro fertilization. This protein localizes to the acrosomal membrane of spermatids and mature spermatozoa where it is thought to play a role in acrosomal morphogenesis and in sperm-egg binding and fusion, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice are infertile and display globozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,886,179 M950L probably benign Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Casp8ap2 C T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 17,820,528 probably null Het
Cfi T A 3: 129,854,992 I175K possibly damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Lrrc37a T G 11: 103,455,512 N3176T possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Mylk G T 16: 34,995,204 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr1440 G A 19: 12,394,550 V96I probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Sptbn2 C T 19: 4,750,632 R2292C probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Spaca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Spaca1 APN 4 34029077 missense probably damaging 0.99
IGL01871:Spaca1 APN 4 34040894 missense probably damaging 0.98
F5770:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
FR4342:Spaca1 UTSW 4 34049838 small insertion probably benign
FR4548:Spaca1 UTSW 4 34049856 small insertion probably benign
FR4737:Spaca1 UTSW 4 34049836 small insertion probably benign
FR4976:Spaca1 UTSW 4 34049844 small insertion probably benign
FR4976:Spaca1 UTSW 4 34049849 small insertion probably benign
R0377:Spaca1 UTSW 4 34044267 unclassified probably null
R1861:Spaca1 UTSW 4 34044206 missense probably damaging 0.99
R3105:Spaca1 UTSW 4 34028468 missense probably damaging 1.00
R4930:Spaca1 UTSW 4 34044236 missense possibly damaging 0.65
R5030:Spaca1 UTSW 4 34039247 missense possibly damaging 0.65
R5137:Spaca1 UTSW 4 34029095 missense probably damaging 1.00
R5264:Spaca1 UTSW 4 34049863 missense possibly damaging 0.53
R6158:Spaca1 UTSW 4 34029176 missense probably damaging 0.99
R6824:Spaca1 UTSW 4 34049869 missense probably benign 0.00
V7581:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
V7582:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
V7583:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTTCCTGTAATTTATGTGCCAGATCC -3'
(R):5'- AGCAACTCTCCTTTTGTTAGAGTGCTTC -3'

Sequencing Primer
(F):5'- actaagtcagaagctctagtgtg -3'
(R):5'- GGCAACCTATTGTGTTTGCTAATG -3'
Posted On2013-09-04