Incidental Mutation 'V7580:Fam221b'
ID69407
Institutional Source Beutler Lab
Gene Symbol Fam221b
Ensembl Gene ENSMUSG00000043633
Gene Namefamily with sequence similarity 221, member B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #V7580 () of strain stinger
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43659622-43669145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43665865 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 249 (T249A)
Ref Sequence ENSEMBL: ENSMUSP00000057398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056474] [ENSMUST00000107864] [ENSMUST00000107865] [ENSMUST00000107866] [ENSMUST00000143339] [ENSMUST00000167153]
Predicted Effect probably benign
Transcript: ENSMUST00000056474
AA Change: T249A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057398
Gene: ENSMUSG00000043633
AA Change: T249A

DomainStartEndE-ValueType
low complexity region 81 105 N/A INTRINSIC
internal_repeat_1 119 164 1.12e-19 PROSPERO
internal_repeat_1 165 210 1.12e-19 PROSPERO
low complexity region 267 285 N/A INTRINSIC
Pfam:DUF4475 312 482 1.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102482
Predicted Effect probably benign
Transcript: ENSMUST00000107864
SMART Domains Protein: ENSMUSP00000103496
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107865
SMART Domains Protein: ENSMUSP00000103497
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107866
SMART Domains Protein: ENSMUSP00000103498
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 45 71 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
EGF 606 642 1.95e1 SMART
Pfam:DUF3522 652 836 1.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134869
Predicted Effect probably benign
Transcript: ENSMUST00000143339
SMART Domains Protein: ENSMUSP00000130133
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143774
Predicted Effect probably benign
Transcript: ENSMUST00000167153
SMART Domains Protein: ENSMUSP00000129760
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Meta Mutation Damage Score 0.1572 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,886,179 M950L probably benign Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Casp8ap2 C T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 17,820,528 probably null Het
Cfi T A 3: 129,854,992 I175K possibly damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Lrrc37a T G 11: 103,455,512 N3176T possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Mylk G T 16: 34,995,204 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr1440 G A 19: 12,394,550 V96I probably benign Het
Otop3 T A 11: 115,344,838 L451Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Slc30a4 T A 2: 122,689,538 M185L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Sptbn2 C T 19: 4,750,632 R2292C probably damaging Het
Tnrc6c G A 11: 117,723,326 R930H probably damaging Het
Trps1 T C 15: 50,831,577 K441E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zmynd8 G A 2: 165,812,394 R749* probably null Het
Other mutations in Fam221b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Fam221b APN 4 43660135 unclassified probably null
IGL01576:Fam221b APN 4 43666227 missense probably benign 0.21
IGL02126:Fam221b APN 4 43666450 missense probably benign 0.01
IGL02407:Fam221b APN 4 43666309 missense possibly damaging 0.73
IGL02425:Fam221b APN 4 43660642 unclassified probably null
IGL03174:Fam221b APN 4 43666542 missense probably benign 0.00
F5770:Fam221b UTSW 4 43665865 missense probably benign
R1785:Fam221b UTSW 4 43665537 missense probably damaging 0.99
R1786:Fam221b UTSW 4 43665537 missense probably damaging 0.99
R1896:Fam221b UTSW 4 43660375 missense probably damaging 0.98
R4091:Fam221b UTSW 4 43665987 missense probably benign 0.01
R4695:Fam221b UTSW 4 43659622 splice site probably null
R5024:Fam221b UTSW 4 43659674 missense probably damaging 1.00
R5778:Fam221b UTSW 4 43660683 missense probably damaging 1.00
R6335:Fam221b UTSW 4 43665942 missense possibly damaging 0.89
V7581:Fam221b UTSW 4 43665865 missense probably benign
V7582:Fam221b UTSW 4 43665865 missense probably benign
V7583:Fam221b UTSW 4 43665865 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGGTTGAATCCTTCTCCCACTG -3'
(R):5'- ATCCCCAAGTATGAGAGTCCCGTC -3'

Sequencing Primer
(F):5'- CCACTGGAAAAGATTGTTCACCTG -3'
(R):5'- TATGAGAGTCCCGTCTCCGAAG -3'
Posted On2013-09-04