Incidental Mutation 'V7580:Cd36'
ID 69410
Institutional Source Beutler Lab
Gene Symbol Cd36
Ensembl Gene ENSMUSG00000002944
Gene Name CD36 molecule
Synonyms FAT, Scarb3, fatty acid translocase
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # V7580 () of strain stinger
Quality Score 217
Status Not validated
Chromosome 5
Chromosomal Location 17986688-18093799 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) ACTGTCTGT to ACTGT at 18025526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082367] [ENSMUST00000165232] [ENSMUST00000169095] [ENSMUST00000170051] [ENSMUST00000197574] [ENSMUST00000197890]
AlphaFold Q08857
Predicted Effect probably null
Transcript: ENSMUST00000082367
SMART Domains Protein: ENSMUSP00000080974
Gene: ENSMUSG00000002944

DomainStartEndE-ValueType
Pfam:CD36 14 463 2.5e-151 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165232
SMART Domains Protein: ENSMUSP00000126300
Gene: ENSMUSG00000002944

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169095
SMART Domains Protein: ENSMUSP00000131832
Gene: ENSMUSG00000002944

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170051
SMART Domains Protein: ENSMUSP00000133008
Gene: ENSMUSG00000002944

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000197574
SMART Domains Protein: ENSMUSP00000143107
Gene: ENSMUSG00000002944

DomainStartEndE-ValueType
Pfam:CD36 12 142 1.8e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000197890
SMART Domains Protein: ENSMUSP00000143061
Gene: ENSMUSG00000002944

DomainStartEndE-ValueType
Pfam:CD36 12 465 2.5e-149 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice exhibit an immunodeficiency phenotype, are susceptible to S. aureus infection and develop ocular pterygium. Mice homozygous for disruptions in this gene display abnormal lipid homeostasis which affects energy utilization in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,849,914 (GRCm39) M950L probably benign Het
Atp6v1h A G 1: 5,194,666 (GRCm39) T282A possibly damaging Het
Casp8ap2 C T 4: 32,639,944 (GRCm39) H333Y probably benign Het
Cfi T A 3: 129,648,641 (GRCm39) I175K possibly damaging Het
D630003M21Rik T C 2: 158,042,931 (GRCm39) T870A probably benign Het
Dnah12 T A 14: 26,495,050 (GRCm39) N1369K possibly damaging Het
Dnajc22 T A 15: 98,999,363 (GRCm39) Y183N probably damaging Het
Erv3 T C 2: 131,697,846 (GRCm39) H171R possibly damaging Het
Fam221b T C 4: 43,665,865 (GRCm39) T249A probably benign Het
Gm10770 T A 2: 150,021,404 (GRCm39) K38* probably null Het
Gm4787 G A 12: 81,424,341 (GRCm39) Q606* probably null Het
Izumo4 A T 10: 80,539,725 (GRCm39) T155S probably benign Het
Kcnb2 A G 1: 15,780,315 (GRCm39) I396V probably benign Het
Klc1 A T 12: 111,741,006 (GRCm39) I161F probably benign Het
Lpar5 C A 6: 125,058,690 (GRCm39) A137E possibly damaging Het
Lrp4 C T 2: 91,318,863 (GRCm39) S900L possibly damaging Het
Lrrc37a T G 11: 103,346,338 (GRCm39) N3176T possibly damaging Het
Med20 G A 17: 47,929,757 (GRCm39) V65M probably damaging Het
Mylk G T 16: 34,815,574 (GRCm39) probably null Het
Numbl T C 7: 26,979,027 (GRCm39) S379P probably benign Het
Or10j7 G T 1: 173,011,531 (GRCm39) L157I probably benign Het
Or5an6 G A 19: 12,371,914 (GRCm39) V96I probably benign Het
Otop3 T A 11: 115,235,664 (GRCm39) L432Q probably damaging Het
Papln C T 12: 83,825,608 (GRCm39) R608C possibly damaging Het
Pelp1 T A 11: 70,288,976 (GRCm39) T257S probably damaging Het
Pigx T C 16: 31,906,240 (GRCm39) D129G probably damaging Het
Pik3cd A C 4: 149,741,776 (GRCm39) L390R probably damaging Het
Plekhb1 T C 7: 100,303,825 (GRCm39) T112A probably benign Het
Ppwd1 A G 13: 104,356,745 (GRCm39) Y257H probably damaging Het
Recql4 T C 15: 76,590,369 (GRCm39) D705G possibly damaging Het
Ror1 A G 4: 100,298,130 (GRCm39) Q501R probably damaging Het
Slc30a4 T A 2: 122,531,458 (GRCm39) M136L probably benign Het
Spaca1 T C 4: 34,039,311 (GRCm39) E192G probably damaging Het
Spata31 C A 13: 65,069,462 (GRCm39) P537T probably benign Het
Sptbn2 C T 19: 4,800,660 (GRCm39) R2292C probably damaging Het
Tnrc6c G A 11: 117,614,152 (GRCm39) R770H probably damaging Het
Trps1 T C 15: 50,694,973 (GRCm39) K150E probably damaging Het
Tspyl3 A G 2: 153,066,980 (GRCm39) V86A probably benign Het
Zfp292 C T 4: 34,806,783 (GRCm39) C2087Y possibly damaging Het
Zmynd8 G A 2: 165,654,314 (GRCm39) R724* probably null Het
Other mutations in Cd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Cd36 APN 5 17,992,700 (GRCm39) missense probably damaging 0.99
IGL01355:Cd36 APN 5 18,018,072 (GRCm39) missense possibly damaging 0.76
IGL02140:Cd36 APN 5 18,033,766 (GRCm39) splice site probably benign
IGL02385:Cd36 APN 5 18,019,717 (GRCm39) missense probably benign 0.31
IGL02626:Cd36 APN 5 18,002,126 (GRCm39) nonsense probably null
IGL02645:Cd36 APN 5 17,990,878 (GRCm39) missense probably benign 0.01
IGL03149:Cd36 APN 5 18,025,563 (GRCm39) missense probably benign 0.02
detached UTSW 5 18,019,721 (GRCm39) missense probably damaging 1.00
oblivious UTSW 5 18,079,964 (GRCm39) intron probably benign
E0370:Cd36 UTSW 5 17,990,747 (GRCm39) nonsense probably null
F5770:Cd36 UTSW 5 18,025,526 (GRCm39) frame shift probably null
R0266:Cd36 UTSW 5 18,003,250 (GRCm39) missense probably benign 0.09
R1102:Cd36 UTSW 5 18,019,211 (GRCm39) missense possibly damaging 0.79
R1120:Cd36 UTSW 5 17,990,826 (GRCm39) missense possibly damaging 0.67
R1170:Cd36 UTSW 5 18,018,086 (GRCm39) missense probably damaging 1.00
R1551:Cd36 UTSW 5 18,002,120 (GRCm39) missense probably benign 0.00
R1918:Cd36 UTSW 5 18,002,034 (GRCm39) nonsense probably null
R4090:Cd36 UTSW 5 17,990,718 (GRCm39) critical splice donor site probably null
R4197:Cd36 UTSW 5 18,018,086 (GRCm39) missense probably damaging 1.00
R5602:Cd36 UTSW 5 18,019,790 (GRCm39) missense possibly damaging 0.94
R5647:Cd36 UTSW 5 18,019,763 (GRCm39) missense probably damaging 1.00
R5867:Cd36 UTSW 5 17,990,733 (GRCm39) missense probably benign 0.05
R6151:Cd36 UTSW 5 18,000,593 (GRCm39) missense probably damaging 1.00
R6400:Cd36 UTSW 5 18,019,721 (GRCm39) missense probably damaging 1.00
R6419:Cd36 UTSW 5 18,002,150 (GRCm39) missense probably benign
R7081:Cd36 UTSW 5 18,019,702 (GRCm39) missense probably damaging 1.00
R7195:Cd36 UTSW 5 18,019,187 (GRCm39) missense probably damaging 1.00
R7420:Cd36 UTSW 5 17,993,272 (GRCm39) missense probably benign 0.09
R8677:Cd36 UTSW 5 18,025,493 (GRCm39) missense probably damaging 1.00
R9460:Cd36 UTSW 5 18,000,608 (GRCm39) missense probably null 0.10
R9526:Cd36 UTSW 5 18,002,033 (GRCm39) missense probably damaging 0.99
R9747:Cd36 UTSW 5 18,019,732 (GRCm39) missense probably benign 0.19
Z1088:Cd36 UTSW 5 18,000,573 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- GCCAACTGCACAGTTTGGGACAT -3'
(R):5'- CACAAGTTCTCACAGGCAGTCCTTTTAT -3'

Sequencing Primer
(F):5'- tcccccataccctcccc -3'
(R):5'- ACAGGCAGTCCTTTTATTTTGAC -3'
Posted On 2013-09-04