Incidental Mutation 'V7580:Plekhb1'
ID69416
Institutional Source Beutler Lab
Gene Symbol Plekhb1
Ensembl Gene ENSMUSG00000030701
Gene Namepleckstrin homology domain containing, family B (evectins) member 1
SynonymsPHR1, Phret1, evt-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #V7580 () of strain stinger
Quality Score170
Status Not validated
Chromosome7
Chromosomal Location100642892-100662414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100654618 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 112 (T112A)
Ref Sequence ENSEMBL: ENSMUSP00000115559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079176] [ENSMUST00000107043] [ENSMUST00000107044] [ENSMUST00000107045] [ENSMUST00000107046] [ENSMUST00000107047] [ENSMUST00000116287] [ENSMUST00000138830] [ENSMUST00000139708] [ENSMUST00000151123] [ENSMUST00000208812]
Predicted Effect probably benign
Transcript: ENSMUST00000079176
AA Change: T112A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078175
Gene: ENSMUSG00000030701
AA Change: T112A

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 216 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107043
AA Change: T93A

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102658
Gene: ENSMUSG00000030701
AA Change: T93A

DomainStartEndE-ValueType
PDB:2D9V|A 2 103 1e-68 PDB
SCOP:d1dbha2 3 97 7e-12 SMART
Blast:PH 3 103 9e-67 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107044
AA Change: T93A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102659
Gene: ENSMUSG00000030701
AA Change: T93A

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 162 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107045
AA Change: T93A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102660
Gene: ENSMUSG00000030701
AA Change: T93A

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 197 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107046
AA Change: T93A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102661
Gene: ENSMUSG00000030701
AA Change: T93A

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 162 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107047
AA Change: T112A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102662
Gene: ENSMUSG00000030701
AA Change: T112A

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 181 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116287
AA Change: T93A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111991
Gene: ENSMUSG00000030701
AA Change: T93A

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 197 218 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135255
Predicted Effect probably benign
Transcript: ENSMUST00000138830
AA Change: T93A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116888
Gene: ENSMUSG00000030701
AA Change: T93A

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139708
AA Change: T93A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000122333
Gene: ENSMUSG00000030701
AA Change: T93A

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151123
AA Change: T112A

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115559
Gene: ENSMUSG00000030701
AA Change: T112A

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 216 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208812
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable with no abnormalities detected in growth, behavior including balance, inner ear histology, or serum and urine electrolyte concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,886,179 M950L probably benign Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Casp8ap2 C T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 17,820,528 probably null Het
Cfi T A 3: 129,854,992 I175K possibly damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Lrrc37a T G 11: 103,455,512 N3176T possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Mylk G T 16: 34,995,204 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr1440 G A 19: 12,394,550 V96I probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Sptbn2 C T 19: 4,750,632 R2292C probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Plekhb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Plekhb1 APN 7 100655299 missense probably damaging 1.00
F5770:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
R0722:Plekhb1 UTSW 7 100645603 missense probably damaging 1.00
R1891:Plekhb1 UTSW 7 100655392 missense probably damaging 1.00
R3427:Plekhb1 UTSW 7 100645650 missense probably damaging 1.00
R5506:Plekhb1 UTSW 7 100644943 unclassified probably null
R5695:Plekhb1 UTSW 7 100655395 missense probably damaging 1.00
R5696:Plekhb1 UTSW 7 100656753 missense probably damaging 1.00
R5789:Plekhb1 UTSW 7 100645586 nonsense probably null
R6633:Plekhb1 UTSW 7 100645639 missense probably damaging 1.00
V7582:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
V7583:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TGTTGCTCAGAGCATAGCTGCC -3'
(R):5'- GACCCCAAGAAGTCAATGTCTGCC -3'

Sequencing Primer
(F):5'- TAGACACTGCCTTGCTGAAG -3'
(R):5'- AAGTCAATGTCTGCCACTGTG -3'
Posted On2013-09-04