Incidental Mutation 'V7580:Pelp1'
ID69419
Institutional Source Beutler Lab
Gene Symbol Pelp1
Ensembl Gene ENSMUSG00000018921
Gene Nameproline, glutamic acid and leucine rich protein 1
SynonymsMNAR, 4930563C04Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #V7580 () of strain stinger
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70392883-70410031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70398150 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 257 (T257S)
Ref Sequence ENSEMBL: ENSMUSP00000019065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019065] [ENSMUST00000135148]
Predicted Effect probably damaging
Transcript: ENSMUST00000019065
AA Change: T257S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019065
Gene: ENSMUSG00000018921
AA Change: T257S

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
Pfam:RIX1 63 232 7.5e-30 PFAM
low complexity region 264 278 N/A INTRINSIC
low complexity region 359 386 N/A INTRINSIC
Pfam:NUC202 424 490 8.6e-30 PFAM
Pfam:NUC202 570 644 6e-19 PFAM
low complexity region 748 758 N/A INTRINSIC
low complexity region 797 830 N/A INTRINSIC
low complexity region 834 863 N/A INTRINSIC
low complexity region 869 877 N/A INTRINSIC
SCOP:d1sig__ 892 958 9e-6 SMART
low complexity region 974 989 N/A INTRINSIC
low complexity region 993 1021 N/A INTRINSIC
low complexity region 1070 1090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135148
SMART Domains Protein: ENSMUSP00000134014
Gene: ENSMUSG00000018921

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
Pfam:RIX1 63 163 2.3e-9 PFAM
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor which coactivates transcription of estrogen receptor responsive genes and corepresses genes activated by other hormone receptors or sequence-specific transcription factors. Expression of this gene is regulated by both members of the estrogen receptor family. This gene may be involved in the progression of several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,886,179 M950L probably benign Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Casp8ap2 C T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 17,820,528 probably null Het
Cfi T A 3: 129,854,992 I175K possibly damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Lrrc37a T G 11: 103,455,512 N3176T possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Mylk G T 16: 34,995,204 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr1440 G A 19: 12,394,550 V96I probably benign Het
Otop3 T A 11: 115,344,838 L451Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Slc30a4 T A 2: 122,689,538 M185L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Sptbn2 C T 19: 4,750,632 R2292C probably damaging Het
Tnrc6c G A 11: 117,723,326 R930H probably damaging Het
Trps1 T C 15: 50,831,577 K441E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zmynd8 G A 2: 165,812,394 R749* probably null Het
Other mutations in Pelp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Pelp1 APN 11 70394812 missense possibly damaging 0.88
IGL00819:Pelp1 APN 11 70394618 missense unknown
IGL01017:Pelp1 APN 11 70396894 missense probably damaging 1.00
IGL01347:Pelp1 APN 11 70395679 missense probably damaging 1.00
IGL01460:Pelp1 APN 11 70393964 missense unknown
IGL02022:Pelp1 APN 11 70406327 unclassified probably benign
IGL02188:Pelp1 APN 11 70409892 missense unknown
ANU74:Pelp1 UTSW 11 70395087 missense probably damaging 0.97
F5770:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
R0056:Pelp1 UTSW 11 70393832 missense unknown
R0201:Pelp1 UTSW 11 70395704 missense possibly damaging 0.84
R0637:Pelp1 UTSW 11 70395704 missense possibly damaging 0.84
R0879:Pelp1 UTSW 11 70395297 splice site probably benign
R1073:Pelp1 UTSW 11 70396590 missense probably damaging 1.00
R1858:Pelp1 UTSW 11 70394742 missense probably damaging 0.99
R1937:Pelp1 UTSW 11 70393715 intron probably null
R1958:Pelp1 UTSW 11 70398521 missense probably damaging 0.99
R3613:Pelp1 UTSW 11 70395435 missense probably benign 0.01
R3722:Pelp1 UTSW 11 70398200 missense possibly damaging 0.62
R4176:Pelp1 UTSW 11 70396867 missense probably damaging 1.00
R5137:Pelp1 UTSW 11 70395099 missense probably damaging 0.98
R5253:Pelp1 UTSW 11 70401661 missense probably damaging 1.00
R5616:Pelp1 UTSW 11 70394862 missense possibly damaging 0.73
R5911:Pelp1 UTSW 11 70396914 missense probably damaging 0.99
R5938:Pelp1 UTSW 11 70394867 missense probably damaging 0.98
R6461:Pelp1 UTSW 11 70396306 missense probably damaging 1.00
V7581:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
V7582:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
V7583:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
Z1088:Pelp1 UTSW 11 70396890 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTTCTGAGTGGGAAAGCAGCATC -3'
(R):5'- TGGTCTGAGGCATCGTTTACAGC -3'

Sequencing Primer
(F):5'- accactgaacccctctcc -3'
(R):5'- ATTGCACAGCATTTGGACC -3'
Posted On2013-09-04