Incidental Mutation 'V7580:Dnajc22'
ID69437
Institutional Source Beutler Lab
Gene Symbol Dnajc22
Ensembl Gene ENSMUSG00000038009
Gene NameDnaJ heat shock protein family (Hsp40) member C22
Synonyms2810451A06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #V7580 () of strain stinger
Quality Score184
Status Not validated
Chromosome15
Chromosomal Location99093170-99104737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99101482 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 183 (Y183N)
Ref Sequence ENSEMBL: ENSMUSP00000055482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061295]
Predicted Effect probably damaging
Transcript: ENSMUST00000061295
AA Change: Y183N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055482
Gene: ENSMUSG00000038009
AA Change: Y183N

DomainStartEndE-ValueType
Pfam:TM2 1 50 1e-10 PFAM
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
DnaJ 276 335 1.09e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146173
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,886,179 M950L probably benign Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Casp8ap2 C T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 17,820,528 probably null Het
Cfi T A 3: 129,854,992 I175K possibly damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Lrrc37a T G 11: 103,455,512 N3176T possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Mylk G T 16: 34,995,204 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr1440 G A 19: 12,394,550 V96I probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Sptbn2 C T 19: 4,750,632 R2292C probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Dnajc22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dnajc22 APN 15 99101178 missense possibly damaging 0.73
IGL00922:Dnajc22 APN 15 99101579 missense possibly damaging 0.89
IGL02155:Dnajc22 APN 15 99101005 missense probably damaging 1.00
IGL02726:Dnajc22 APN 15 99101000 missense probably damaging 1.00
IGL03074:Dnajc22 APN 15 99101522 missense probably damaging 1.00
F5770:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
R1138:Dnajc22 UTSW 15 99104427 small deletion probably benign
R1628:Dnajc22 UTSW 15 99100936 start codon destroyed probably null 1.00
R2018:Dnajc22 UTSW 15 99101233 missense probably benign 0.06
R2146:Dnajc22 UTSW 15 99104383 missense probably benign 0.04
R4342:Dnajc22 UTSW 15 99104464 nonsense probably null
R4950:Dnajc22 UTSW 15 99101734 missense probably benign 0.29
V7581:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
V7582:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
V7583:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGTTGGTAACCAGACCTCAGAC -3'
(R):5'- TCATGCAAGCTACAAGCTCCTGC -3'

Sequencing Primer
(F):5'- CTTTAAGAATACCTTAGGAGCGGC -3'
(R):5'- TCTCTGAGGAGACTTACCCGAAG -3'
Posted On2013-09-04