Incidental Mutation 'V7580:Med20'
ID69440
Institutional Source Beutler Lab
Gene Symbol Med20
Ensembl Gene ENSMUSG00000092558
Gene Namemediator complex subunit 20
SynonymsTrfp, 1110011O05Rik, 2410115I17Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #V7580 () of strain stinger
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location47611582-47624418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47618832 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 65 (V65M)
Ref Sequence ENSEMBL: ENSMUSP00000117658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024778] [ENSMUST00000132397]
Predicted Effect probably damaging
Transcript: ENSMUST00000024778
AA Change: V65M

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024778
Gene: ENSMUSG00000092558
AA Change: V65M

DomainStartEndE-ValueType
Pfam:Med20 1 198 6.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130830
Predicted Effect probably damaging
Transcript: ENSMUST00000132397
AA Change: V65M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117658
Gene: ENSMUSG00000023984
AA Change: V65M

DomainStartEndE-ValueType
Pfam:Med20 1 149 1.6e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149893
Meta Mutation Damage Score 0.574 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. A mutation in this gene has been associated with a novel infantile-onset neurodegenerative movement disorder. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,886,179 M950L probably benign Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Casp8ap2 C T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 17,820,528 probably null Het
Cfi T A 3: 129,854,992 I175K possibly damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Lrrc37a T G 11: 103,455,512 N3176T possibly damaging Het
Mylk G T 16: 34,995,204 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr1440 G A 19: 12,394,550 V96I probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Sptbn2 C T 19: 4,750,632 R2292C probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Med20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Med20 APN 17 47623000 missense possibly damaging 0.92
R0847:Med20 UTSW 17 47611693 critical splice donor site probably null
R0881:Med20 UTSW 17 47611680 start codon destroyed probably null 1.00
R4460:Med20 UTSW 17 47618917 missense probably benign 0.39
R4461:Med20 UTSW 17 47618917 missense probably benign 0.39
R5212:Med20 UTSW 17 47618850 missense probably benign 0.02
R5605:Med20 UTSW 17 47623144 intron probably benign
V7582:Med20 UTSW 17 47618832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCCAAGAATTTTCTGGTGCTCG -3'
(R):5'- AGCCCACAGCATATCCTGCTTGTC -3'

Sequencing Primer
(F):5'- GCTGGCTTTTCCAATTACCCG -3'
(R):5'- GGTCTTACCTCCACAGAGATG -3'
Posted On2013-09-04