Incidental Mutation 'V7580:Olfr1440'
ID69442
Institutional Source Beutler Lab
Gene Symbol Olfr1440
Ensembl Gene ENSMUSG00000046650
Gene Nameolfactory receptor 1440
SynonymsMOR215-1, GA_x6K02T2RE5P-2725206-2726153
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #V7580 () of strain stinger
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12387279-12401584 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12394550 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 96 (V96I)
Ref Sequence ENSEMBL: ENSMUSP00000054798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054567] [ENSMUST00000213657] [ENSMUST00000213894] [ENSMUST00000216145] [ENSMUST00000217062]
Predicted Effect probably benign
Transcript: ENSMUST00000054567
AA Change: V96I

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000054798
Gene: ENSMUSG00000046650
AA Change: V96I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.5e-52 PFAM
Pfam:7tm_1 42 291 7.2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208644
AA Change: V96I
Predicted Effect probably benign
Transcript: ENSMUST00000213657
AA Change: V96I

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000213894
AA Change: V96I

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214082
Predicted Effect probably benign
Transcript: ENSMUST00000216145
AA Change: V96I

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216773
Predicted Effect probably benign
Transcript: ENSMUST00000217062
AA Change: V96I

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1328 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,886,179 M950L probably benign Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Casp8ap2 C T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 17,820,528 probably null Het
Cfi T A 3: 129,854,992 I175K possibly damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Lrrc37a T G 11: 103,455,512 N3176T possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Mylk G T 16: 34,995,204 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Otop3 T A 11: 115,344,838 L451Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Slc30a4 T A 2: 122,689,538 M185L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Sptbn2 C T 19: 4,750,632 R2292C probably damaging Het
Tnrc6c G A 11: 117,723,326 R930H probably damaging Het
Trps1 T C 15: 50,831,577 K441E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zmynd8 G A 2: 165,812,394 R749* probably null Het
Other mutations in Olfr1440
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Olfr1440 APN 19 12394899 missense probably damaging 0.97
IGL02517:Olfr1440 APN 19 12394901 missense probably benign
IGL03173:Olfr1440 APN 19 12395046 missense possibly damaging 0.79
IGL03412:Olfr1440 APN 19 12394379 missense probably damaging 1.00
F5770:Olfr1440 UTSW 19 12394550 missense probably benign 0.19
R0240:Olfr1440 UTSW 19 12394963 missense probably benign 0.01
R0240:Olfr1440 UTSW 19 12394963 missense probably benign 0.01
R1184:Olfr1440 UTSW 19 12394857 missense probably benign 0.02
R1430:Olfr1440 UTSW 19 12394437 missense probably benign 0.34
R4111:Olfr1440 UTSW 19 12394301 missense probably damaging 1.00
R5751:Olfr1440 UTSW 19 12394416 missense probably benign 0.01
R6796:Olfr1440 UTSW 19 12394928 missense probably damaging 0.99
Z1088:Olfr1440 UTSW 19 12394299 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GTGTGGAACTTGGGCCTCATCATC -3'
(R):5'- TAACCCTGGGAACTGTTGGAGCTG -3'

Sequencing Primer
(F):5'- GGATTGACCCTTACCTACACAC -3'
(R):5'- GTATTGAATGCCTTGGACCTAC -3'
Posted On2013-09-04