Incidental Mutation 'R0766:Trank1'
ID69506
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Nametetratricopeptide repeat and ankyrin repeat containing 1
SynonymsA230061D21Rik, LOC235639, C030048J01Rik, Lba1
MMRRC Submission 038946-MU
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0766 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location111311739-111395775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 111347469 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 270 (S270A)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626] [ENSMUST00000197049]
Predicted Effect probably benign
Transcript: ENSMUST00000078626
AA Change: S270A

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: S270A

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197049
SMART Domains Protein: ENSMUSP00000143534
Gene: ENSMUSG00000062296

DomainStartEndE-ValueType
Blast:TPR 15 48 3e-17 BLAST
SCOP:d1ihga1 15 84 8e-10 SMART
Blast:TPR 49 82 4e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200151
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
A2m T C 6: 121,676,890 probably benign Het
Card14 T C 11: 119,324,176 S241P probably damaging Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dnah5 A C 15: 28,448,487 K4232T probably null Het
Eml6 A G 11: 29,831,219 probably benign Het
Esd T C 14: 74,742,121 S122P probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Herc1 C T 9: 66,504,840 P4781S probably damaging Het
Iqch G A 9: 63,482,683 S738L probably benign Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Itpr1 A G 6: 108,410,900 E1533G probably damaging Het
Klrg1 T C 6: 122,279,663 M55V probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Otos A C 1: 92,645,351 L14R probably damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Snai2 T A 16: 14,708,247 M254K possibly damaging Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex22 A G 12: 113,088,523 N67S possibly damaging Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Wdfy4 T C 14: 33,140,612 E601G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTTTGCTCACAGGCAGCCAG -3'
(R):5'- TGCCCGAGAATAGAATGAATGGCAC -3'

Sequencing Primer
(F):5'- AGCCAGCAAGATAACTAGACAG -3'
(R):5'- TGAATGGCACATCTACAATAAAGCAG -3'
Posted On2013-09-30