Incidental Mutation 'R0759:Map3k19'
ID69992
Institutional Source Beutler Lab
Gene Symbol Map3k19
Ensembl Gene ENSMUSG00000051590
Gene Namemitogen-activated protein kinase kinase kinase 19
SynonymsYsk4
MMRRC Submission 038939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R0759 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location127815253-127855031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127817425 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1227 (Y1227H)
Ref Sequence ENSEMBL: ENSMUSP00000056254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061512] [ENSMUST00000208183]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061512
AA Change: Y1227H

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590
AA Change: Y1227H

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
S_TKc 1044 1307 3.18e-90 SMART
Predicted Effect unknown
Transcript: ENSMUST00000187653
AA Change: Y1126H
SMART Domains Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590
AA Change: Y1126H

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
S_TKc 933 1196 1.5e-92 SMART
Predicted Effect unknown
Transcript: ENSMUST00000189398
AA Change: Y382H
SMART Domains Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590
AA Change: Y382H

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 216 452 4.8e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000191333
AA Change: Y430H
SMART Domains Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590
AA Change: Y430H

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 237 500 1.5e-92 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000208183
AA Change: Y1431H

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,662,497 F504I possibly damaging Het
A430078G23Rik T G 8: 3,388,822 probably benign Het
Amdhd2 C A 17: 24,161,613 C119F probably benign Het
Bsph2 A T 7: 13,556,727 Y76N probably damaging Het
C1s1 T C 6: 124,531,437 N531S probably damaging Het
Ces1c G A 8: 93,130,864 Q30* probably null Het
Cltc A C 11: 86,737,082 I80S probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Cxcl16 C T 11: 70,459,128 C24Y probably damaging Het
Cyhr1 A G 15: 76,646,185 *312Q probably null Het
Dennd4c A G 4: 86,788,829 I348V probably damaging Het
Elavl1 C A 8: 4,289,815 D256Y probably damaging Het
Fubp1 TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGGCGG 3: 152,210,637 probably benign Het
Gm43434 T G 14: 54,145,495 probably benign Het
Il1a T A 2: 129,304,687 D162V probably damaging Het
Myb C T 10: 21,145,028 V501I probably benign Het
Nav1 A G 1: 135,455,260 I1238T possibly damaging Het
Nr0b2 A T 4: 133,553,738 Q105L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pdilt A T 7: 119,489,484 Y431* probably null Het
Plg A G 17: 12,410,951 H624R probably damaging Het
Ppl A G 16: 5,089,777 S885P probably benign Het
Ptdss1 T C 13: 66,987,804 L375P probably damaging Het
Rrm1 A G 7: 102,457,561 D347G probably benign Het
Sbf1 A T 15: 89,304,716 V573E probably damaging Het
Slc9a1 T A 4: 133,416,403 I400N probably damaging Het
Slurp1 A G 15: 74,726,959 F61S probably damaging Het
Smpd3 T C 8: 106,265,228 E231G probably benign Het
Sned1 C T 1: 93,272,564 T564M probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trim35 T A 14: 66,308,787 D334E probably benign Het
Trp53i11 A G 2: 93,198,958 T101A possibly damaging Het
Usp9y T C Y: 1,299,097 N2514D probably damaging Het
Xpc A T 6: 91,498,142 Y634N probably damaging Het
Other mutations in Map3k19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Map3k19 APN 1 127824331 nonsense probably null
IGL01367:Map3k19 APN 1 127824351 missense possibly damaging 0.88
IGL01443:Map3k19 APN 1 127838507 missense probably benign 0.38
IGL01481:Map3k19 APN 1 127822478 missense probably damaging 0.99
IGL01530:Map3k19 APN 1 127822104 missense probably damaging 1.00
IGL01603:Map3k19 APN 1 127830273 missense possibly damaging 0.89
IGL02044:Map3k19 APN 1 127823505 missense probably damaging 1.00
IGL02159:Map3k19 APN 1 127823170 missense probably benign 0.00
IGL02296:Map3k19 APN 1 127824246 missense probably damaging 1.00
IGL02349:Map3k19 APN 1 127823769 missense possibly damaging 0.48
IGL02823:Map3k19 APN 1 127822264 missense probably benign 0.01
IGL02965:Map3k19 APN 1 127824066 missense probably damaging 0.98
IGL03137:Map3k19 APN 1 127824315 missense probably benign 0.04
R0125:Map3k19 UTSW 1 127823100 missense probably benign 0.07
R0265:Map3k19 UTSW 1 127822182 missense possibly damaging 0.61
R0389:Map3k19 UTSW 1 127822415 missense probably benign 0.08
R0443:Map3k19 UTSW 1 127822415 missense probably benign 0.08
R0465:Map3k19 UTSW 1 127838527 missense probably damaging 1.00
R0645:Map3k19 UTSW 1 127822182 missense possibly damaging 0.61
R0815:Map3k19 UTSW 1 127834638 splice site probably benign
R0838:Map3k19 UTSW 1 127823959 missense probably benign 0.13
R1173:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1174:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1175:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1457:Map3k19 UTSW 1 127817898 missense probably damaging 1.00
R1661:Map3k19 UTSW 1 127817656 missense possibly damaging 0.95
R1665:Map3k19 UTSW 1 127817656 missense possibly damaging 0.95
R1753:Map3k19 UTSW 1 127822680 missense probably benign 0.02
R1944:Map3k19 UTSW 1 127823122 missense probably benign 0.29
R2496:Map3k19 UTSW 1 127823086 missense probably damaging 1.00
R2878:Map3k19 UTSW 1 127823793 missense possibly damaging 0.61
R2895:Map3k19 UTSW 1 127822098 missense possibly damaging 0.60
R3025:Map3k19 UTSW 1 127838553 critical splice acceptor site probably null
R4577:Map3k19 UTSW 1 127822813 nonsense probably null
R4612:Map3k19 UTSW 1 127815300 missense probably benign 0.07
R4888:Map3k19 UTSW 1 127817733 missense probably damaging 1.00
R4927:Map3k19 UTSW 1 127822195 missense probably benign 0.08
R5028:Map3k19 UTSW 1 127823232 missense probably benign 0.00
R5050:Map3k19 UTSW 1 127823562 missense probably benign 0.21
R5131:Map3k19 UTSW 1 127823690 missense possibly damaging 0.78
R5556:Map3k19 UTSW 1 127834547 nonsense probably null
R5606:Map3k19 UTSW 1 127822957 missense probably benign
R5617:Map3k19 UTSW 1 127822966 missense probably damaging 1.00
R5755:Map3k19 UTSW 1 127822381 missense probably benign 0.02
R5854:Map3k19 UTSW 1 127830355 missense probably damaging 0.96
R5952:Map3k19 UTSW 1 127822740 missense probably benign 0.01
R6132:Map3k19 UTSW 1 127850476 missense possibly damaging 0.53
R6175:Map3k19 UTSW 1 127822832 missense probably benign 0.05
R6261:Map3k19 UTSW 1 127822599 missense possibly damaging 0.95
R6471:Map3k19 UTSW 1 127817254 missense probably damaging 1.00
R6726:Map3k19 UTSW 1 127820448 missense probably benign 0.09
R6732:Map3k19 UTSW 1 127824232 missense probably benign 0.37
R6762:Map3k19 UTSW 1 127847264 missense probably damaging 1.00
R7366:Map3k19 UTSW 1 127817455 missense probably damaging 1.00
R7414:Map3k19 UTSW 1 127838452 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGAACTTTGAGTGGGCCACAG -3'
(R):5'- AACGTCATGCTCATGCCAACGG -3'

Sequencing Primer
(F):5'- GAAAGGAATAGCTTCTTTGGGACTC -3'
(R):5'- CTCATGCCAACGGGAATAATAAAG -3'
Posted On2013-09-30