Incidental Mutation 'R0759:Trp53i11'
ID69994
Institutional Source Beutler Lab
Gene Symbol Trp53i11
Ensembl Gene ENSMUSG00000068735
Gene Nametransformation related protein 53 inducible protein 11
SynonymsTp53i11
MMRRC Submission 038939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R0759 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location93187548-93201759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93198958 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 101 (T101A)
Ref Sequence ENSEMBL: ENSMUSP00000106897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090554] [ENSMUST00000111265] [ENSMUST00000111266] [ENSMUST00000150462]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090554
AA Change: T101A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088042
Gene: ENSMUSG00000068735
AA Change: T101A

DomainStartEndE-ValueType
Pfam:p53-inducible11 10 188 8.5e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111265
SMART Domains Protein: ENSMUSP00000106896
Gene: ENSMUSG00000027217

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 247 3.3e-50 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111266
AA Change: T101A

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106897
Gene: ENSMUSG00000068735
AA Change: T101A

DomainStartEndE-ValueType
Pfam:p53-inducible11 10 188 2.1e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147377
Predicted Effect probably benign
Transcript: ENSMUST00000150462
SMART Domains Protein: ENSMUSP00000115918
Gene: ENSMUSG00000068735

DomainStartEndE-ValueType
Pfam:p53-inducible11 10 87 1.5e-48 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,662,497 F504I possibly damaging Het
A430078G23Rik T G 8: 3,388,822 probably benign Het
Amdhd2 C A 17: 24,161,613 C119F probably benign Het
Bsph2 A T 7: 13,556,727 Y76N probably damaging Het
C1s1 T C 6: 124,531,437 N531S probably damaging Het
Ces1c G A 8: 93,130,864 Q30* probably null Het
Cltc A C 11: 86,737,082 I80S probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Cxcl16 C T 11: 70,459,128 C24Y probably damaging Het
Cyhr1 A G 15: 76,646,185 *312Q probably null Het
Dennd4c A G 4: 86,788,829 I348V probably damaging Het
Elavl1 C A 8: 4,289,815 D256Y probably damaging Het
Fubp1 TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGGCGG 3: 152,210,637 probably benign Het
Gm43434 T G 14: 54,145,495 probably benign Het
Il1a T A 2: 129,304,687 D162V probably damaging Het
Map3k19 A G 1: 127,817,425 Y1227H possibly damaging Het
Myb C T 10: 21,145,028 V501I probably benign Het
Nav1 A G 1: 135,455,260 I1238T possibly damaging Het
Nr0b2 A T 4: 133,553,738 Q105L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pdilt A T 7: 119,489,484 Y431* probably null Het
Plg A G 17: 12,410,951 H624R probably damaging Het
Ppl A G 16: 5,089,777 S885P probably benign Het
Ptdss1 T C 13: 66,987,804 L375P probably damaging Het
Rrm1 A G 7: 102,457,561 D347G probably benign Het
Sbf1 A T 15: 89,304,716 V573E probably damaging Het
Slc9a1 T A 4: 133,416,403 I400N probably damaging Het
Slurp1 A G 15: 74,726,959 F61S probably damaging Het
Smpd3 T C 8: 106,265,228 E231G probably benign Het
Sned1 C T 1: 93,272,564 T564M probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trim35 T A 14: 66,308,787 D334E probably benign Het
Usp9y T C Y: 1,299,097 N2514D probably damaging Het
Xpc A T 6: 91,498,142 Y634N probably damaging Het
Other mutations in Trp53i11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0011:Trp53i11 UTSW 2 93199353 unclassified probably benign
R0011:Trp53i11 UTSW 2 93199353 unclassified probably benign
R0137:Trp53i11 UTSW 2 93199351 unclassified probably benign
R0148:Trp53i11 UTSW 2 93197735 missense probably damaging 1.00
R4700:Trp53i11 UTSW 2 93199900 missense probably damaging 1.00
R5451:Trp53i11 UTSW 2 93199855 missense possibly damaging 0.85
R5466:Trp53i11 UTSW 2 93199383 missense possibly damaging 0.51
R5626:Trp53i11 UTSW 2 93199378 missense possibly damaging 0.95
R6709:Trp53i11 UTSW 2 93199818 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGACATCCTGTCCATTACTGGTGTG -3'
(R):5'- AGGAGATGCCTGTTGGAATCAAGC -3'

Sequencing Primer
(F):5'- GTAACCAGCACACATGCTCTG -3'
(R):5'- CTTTATCTACACAATGGGGCAAGG -3'
Posted On2013-09-30