Incidental Mutation 'R0760:Fam71d'
ID70058
Institutional Source Beutler Lab
Gene Symbol Fam71d
Ensembl Gene ENSMUSG00000056987
Gene Namefamily with sequence similarity 71, member D
Synonyms
MMRRC Submission 038940-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0760 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location78691535-78734516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78715153 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 197 (D197G)
Ref Sequence ENSEMBL: ENSMUSP00000151845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077968] [ENSMUST00000218697] [ENSMUST00000219507] [ENSMUST00000219551] [ENSMUST00000220101] [ENSMUST00000220396]
Predicted Effect probably damaging
Transcript: ENSMUST00000077968
AA Change: D197G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077119
Gene: ENSMUSG00000056987
AA Change: D197G

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
Pfam:DUF3699 111 184 1.6e-25 PFAM
low complexity region 237 250 N/A INTRINSIC
low complexity region 265 284 N/A INTRINSIC
low complexity region 391 402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218697
Predicted Effect probably benign
Transcript: ENSMUST00000219507
Predicted Effect probably damaging
Transcript: ENSMUST00000219551
AA Change: D197G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219572
Predicted Effect probably benign
Transcript: ENSMUST00000220101
Predicted Effect probably benign
Transcript: ENSMUST00000220212
Predicted Effect probably benign
Transcript: ENSMUST00000220396
Meta Mutation Damage Score 0.018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.8%
Validation Efficiency 95% (39/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,347,702 V120A possibly damaging Het
Adamts2 T C 11: 50,775,326 V383A probably damaging Het
Alcam C T 16: 52,295,672 V180M probably benign Het
Catip A G 1: 74,362,959 probably benign Het
Ccm2l A C 2: 153,072,184 N298T probably damaging Het
Ccni A G 5: 93,183,329 V261A possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyb5d1 A G 11: 69,395,173 F41L probably benign Het
Fbxw8 A G 5: 118,065,901 probably null Het
Gpaa1 T C 15: 76,331,919 I33T probably benign Het
Grip1 T A 10: 120,018,078 S512T probably damaging Het
Gtpbp1 G A 15: 79,719,155 G140E probably damaging Het
Hspa4l T A 3: 40,784,723 L681* probably null Het
Hspg2 A G 4: 137,512,349 T456A probably damaging Het
Igkv3-1 A T 6: 70,704,135 D106V probably damaging Het
Inhbc C T 10: 127,357,368 G260S probably damaging Het
Itga2 C T 13: 114,859,632 V708I possibly damaging Het
Kif5c T C 2: 49,688,753 I131T probably damaging Het
Kmt2c A G 5: 25,353,317 Y1133H possibly damaging Het
Lama2 A G 10: 27,044,433 probably null Het
N4bp1 A G 8: 86,846,912 Y744H probably damaging Het
Olfr128 C T 17: 37,924,114 Q183* probably null Het
Olfr354 A G 2: 36,907,221 S92G probably benign Het
Ovol2 A G 2: 144,331,759 probably null Het
Pappa2 C A 1: 158,716,961 probably null Het
Pcdh10 G A 3: 45,380,570 E440K probably benign Het
Pcsk4 A G 10: 80,325,941 probably benign Het
Plcl2 A G 17: 50,608,774 N937S possibly damaging Het
Ppp6r1 A G 7: 4,639,723 F541L probably benign Het
Rad54l2 A G 9: 106,719,606 probably null Het
Ranbp2 C T 10: 58,476,791 P1111L possibly damaging Het
Rasal3 A G 17: 32,392,172 F929S probably benign Het
Rnf111 A G 9: 70,429,678 V909A probably damaging Het
Rnf168 A G 16: 32,298,386 probably null Het
Slc2a5 T C 4: 150,139,667 L244P probably benign Het
Snta1 T A 2: 154,380,940 I288F probably damaging Het
Sv2a G A 3: 96,188,182 C297Y probably damaging Het
Trim44 C T 2: 102,400,560 probably benign Het
Uggt1 A T 1: 36,161,724 I1164N possibly damaging Het
Other mutations in Fam71d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02123:Fam71d APN 12 78734207 critical splice donor site probably null
IGL02738:Fam71d APN 12 78734215 splice site probably benign
R1832:Fam71d UTSW 12 78715506 unclassified probably benign
R1833:Fam71d UTSW 12 78715506 unclassified probably benign
R4335:Fam71d UTSW 12 78712232 missense possibly damaging 0.77
R4437:Fam71d UTSW 12 78715050 missense probably damaging 1.00
R4850:Fam71d UTSW 12 78715153 missense probably damaging 1.00
R5234:Fam71d UTSW 12 78715271 nonsense probably null
R5445:Fam71d UTSW 12 78715116 missense probably damaging 1.00
R5587:Fam71d UTSW 12 78715075 missense probably damaging 0.99
R5965:Fam71d UTSW 12 78710306 missense unknown
R5993:Fam71d UTSW 12 78715436 missense probably damaging 0.98
R6644:Fam71d UTSW 12 78715286 missense probably damaging 1.00
R6660:Fam71d UTSW 12 78715357 missense possibly damaging 0.88
R7052:Fam71d UTSW 12 78719402 missense probably benign 0.00
R7098:Fam71d UTSW 12 78719634 critical splice donor site probably null
U24488:Fam71d UTSW 12 78715037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATTGACTGCCTCATTCTCCAAG -3'
(R):5'- CGGTGACATCAGTGACATCTGTGAC -3'

Sequencing Primer
(F):5'- GTGCTAAGAACATGCGTCTC -3'
(R):5'- tgacatctgtgacatcagtgac -3'
Posted On2013-09-30