Incidental Mutation 'R0746:Thsd7b'
ID70115
Institutional Source Beutler Lab
Gene Symbol Thsd7b
Ensembl Gene ENSMUSG00000042581
Gene Namethrombospondin, type I, domain containing 7B
Synonyms1700074E13Rik, D130067I03Rik
MMRRC Submission 038927-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R0746 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location129273302-130219278 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 130188531 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1340 (H1340Q)
Ref Sequence ENSEMBL: ENSMUSP00000073220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073527]
Predicted Effect probably benign
Transcript: ENSMUST00000073527
AA Change: H1340Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: H1340Q

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 5e-29 BLAST
Blast:TSP1 122 177 9e-24 BLAST
TSP1 182 233 2.47e-9 SMART
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 2e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 6e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1059 3.96e-8 SMART
TSP1 1062 1126 1.73e0 SMART
TSP1 1131 1182 6.05e-4 SMART
TSP1 1185 1246 9.52e-1 SMART
TSP1 1251 1303 3.21e-8 SMART
TSP1 1304 1369 5.52e-1 SMART
TSP1 1374 1432 3.92e-2 SMART
transmembrane domain 1558 1580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140834
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik T C 17: 79,628,286 probably benign Het
Acvr1 T C 2: 58,500,550 M1V probably null Het
Adamts10 T A 17: 33,549,547 C866* probably null Het
Adgrv1 G A 13: 81,570,556 P4S probably benign Het
Arhgef37 A G 18: 61,517,993 probably null Het
Arid4b A G 13: 14,143,038 T169A probably benign Het
Cabp7 A T 11: 4,738,900 I190N probably damaging Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Ces1d A G 8: 93,189,468 F177S probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Csmd2 T A 4: 128,414,297 C1283S probably damaging Het
Cul1 T C 6: 47,518,288 probably null Het
F7 T G 8: 13,034,740 S255R probably benign Het
Fanci T A 7: 79,439,681 I955N probably damaging Het
Focad C A 4: 88,397,214 D1536E possibly damaging Het
Fus A G 7: 127,985,424 probably benign Het
Gpr146 C T 5: 139,393,222 R260W probably damaging Het
Grid1 T C 14: 34,822,690 F73L possibly damaging Het
Ilf2 T A 3: 90,482,807 V142D probably damaging Het
Kcna2 A G 3: 107,105,168 D355G probably benign Het
Mgat4c T C 10: 102,388,687 F254S probably damaging Het
Mrps10 A C 17: 47,372,639 R139S probably benign Het
Myh2 A G 11: 67,173,431 T71A probably benign Het
Myo1d A C 11: 80,586,879 Y893D possibly damaging Het
Ncapd2 T C 6: 125,174,264 E760G possibly damaging Het
Olfr509 A T 7: 108,646,041 D178E probably damaging Het
Olfr745 T A 14: 50,642,775 probably null Het
Pkhd1 T A 1: 20,198,107 D3349V probably damaging Het
Ptprn2 A C 12: 116,901,017 M551L probably benign Het
Ptprq A G 10: 107,517,831 Y2275H probably damaging Het
Rfx7 A G 9: 72,619,106 T1193A probably benign Het
Rtl1 T C 12: 109,592,960 D815G probably damaging Het
Scn1a T A 2: 66,351,126 T18S probably benign Het
Sept5 T C 16: 18,623,225 H277R probably damaging Het
Sh3bp5l A G 11: 58,346,347 S377G probably benign Het
Snx2 T A 18: 53,197,889 I142K possibly damaging Het
Spata31d1a C A 13: 59,702,263 D684Y possibly damaging Het
Taar6 C A 10: 23,985,360 S96I probably benign Het
Tmem115 C T 9: 107,537,999 T329M probably benign Het
Tmem50b C T 16: 91,581,690 probably null Het
Uhrf1bp1l T A 10: 89,805,454 I829K probably benign Het
Wdr64 A T 1: 175,792,973 D316V possibly damaging Het
Yars C A 4: 129,197,286 S162R probably damaging Het
Other mutations in Thsd7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thsd7b APN 1 129595834 missense probably damaging 1.00
IGL00850:Thsd7b APN 1 130165077 missense probably benign 0.00
IGL00987:Thsd7b APN 1 129613279 missense probably damaging 1.00
IGL01068:Thsd7b APN 1 129596146 missense probably damaging 1.00
IGL01091:Thsd7b APN 1 129776334 missense probably benign 0.29
IGL01535:Thsd7b APN 1 129678217 missense possibly damaging 0.64
IGL01560:Thsd7b APN 1 130218181 utr 3 prime probably benign
IGL01701:Thsd7b APN 1 129430928 missense probably benign 0.07
IGL01775:Thsd7b APN 1 129628939 missense probably damaging 0.99
IGL02077:Thsd7b APN 1 129816682 missense probably damaging 1.00
IGL02338:Thsd7b APN 1 129595771 missense probably damaging 1.00
IGL02340:Thsd7b APN 1 130159632 missense probably benign 0.01
IGL02404:Thsd7b APN 1 129613151 missense probably damaging 1.00
IGL02519:Thsd7b APN 1 129613195 missense probably benign 0.22
IGL02543:Thsd7b APN 1 130165103 missense probably benign 0.03
IGL02740:Thsd7b APN 1 129613127 missense probably damaging 0.99
IGL02793:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02875:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02986:Thsd7b APN 1 129915615 missense probably benign 0.01
IGL03108:Thsd7b APN 1 130210276 missense probably damaging 1.00
IGL03114:Thsd7b APN 1 130188551 missense probably benign 0.00
IGL03195:Thsd7b APN 1 129628909 missense probably damaging 1.00
IGL03291:Thsd7b APN 1 129760355 missense possibly damaging 0.94
IGL03397:Thsd7b APN 1 129596164 missense probably benign 0.17
IGL03399:Thsd7b APN 1 129628885 missense probably damaging 1.00
R0184:Thsd7b UTSW 1 129430964 missense probably benign 0.00
R0277:Thsd7b UTSW 1 130195263 missense probably benign 0.00
R0526:Thsd7b UTSW 1 129951392 missense probably damaging 1.00
R0633:Thsd7b UTSW 1 130188526 missense possibly damaging 0.78
R0784:Thsd7b UTSW 1 129595359 splice site probably benign
R1158:Thsd7b UTSW 1 130189935 synonymous probably null
R1267:Thsd7b UTSW 1 129628840 intron probably null
R1375:Thsd7b UTSW 1 130159686 missense probably damaging 1.00
R1565:Thsd7b UTSW 1 129596041 missense possibly damaging 0.94
R1728:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1728:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1728:Thsd7b UTSW 1 129678183 missense probably benign
R1728:Thsd7b UTSW 1 130116631 missense probably benign
R1729:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1729:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1729:Thsd7b UTSW 1 129678183 missense probably benign
R1729:Thsd7b UTSW 1 130116631 missense probably benign
R1730:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1730:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1730:Thsd7b UTSW 1 129678183 missense probably benign
R1730:Thsd7b UTSW 1 130116631 missense probably benign
R1739:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1739:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1739:Thsd7b UTSW 1 129678183 missense probably benign
R1739:Thsd7b UTSW 1 130116631 missense probably benign
R1762:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1762:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1762:Thsd7b UTSW 1 129678183 missense probably benign
R1762:Thsd7b UTSW 1 130103076 missense possibly damaging 0.92
R1762:Thsd7b UTSW 1 130116631 missense probably benign
R1783:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1783:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1783:Thsd7b UTSW 1 129678183 missense probably benign
R1783:Thsd7b UTSW 1 130116631 missense probably benign
R1784:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1784:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1784:Thsd7b UTSW 1 129678183 missense probably benign
R1784:Thsd7b UTSW 1 130116631 missense probably benign
R1785:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1785:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1785:Thsd7b UTSW 1 129678183 missense probably benign
R1785:Thsd7b UTSW 1 130116631 missense probably benign
R1812:Thsd7b UTSW 1 129758610 missense probably damaging 1.00
R1846:Thsd7b UTSW 1 129613256 missense probably damaging 1.00
R1908:Thsd7b UTSW 1 129678109 missense probably damaging 0.99
R1996:Thsd7b UTSW 1 129758451 nonsense probably null
R2199:Thsd7b UTSW 1 130218158 missense probably benign 0.04
R2483:Thsd7b UTSW 1 130103072 missense probably damaging 1.00
R2919:Thsd7b UTSW 1 130189850 splice site probably benign
R2935:Thsd7b UTSW 1 129678087 missense possibly damaging 0.83
R3113:Thsd7b UTSW 1 130049862 missense probably benign 0.23
R3236:Thsd7b UTSW 1 130218118 nonsense probably null
R3745:Thsd7b UTSW 1 129678241 missense probably benign 0.04
R3877:Thsd7b UTSW 1 130190182 missense possibly damaging 0.92
R3880:Thsd7b UTSW 1 129595370 missense probably damaging 1.00
R4110:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4112:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4255:Thsd7b UTSW 1 129760287 missense possibly damaging 0.79
R4621:Thsd7b UTSW 1 129430915 missense possibly damaging 0.47
R4703:Thsd7b UTSW 1 130049909 intron probably benign
R4732:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4733:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4755:Thsd7b UTSW 1 130210264 missense probably benign 0.01
R4805:Thsd7b UTSW 1 130188539 missense probably benign 0.04
R4840:Thsd7b UTSW 1 129595844 missense probably benign 0.00
R4879:Thsd7b UTSW 1 130188499 missense possibly damaging 0.62
R4936:Thsd7b UTSW 1 129678145 missense probably benign 0.00
R4972:Thsd7b UTSW 1 130188572 missense probably damaging 0.97
R5304:Thsd7b UTSW 1 129678243 nonsense probably null
R5422:Thsd7b UTSW 1 129921334 missense probably benign 0.41
R5495:Thsd7b UTSW 1 129595833 missense probably damaging 1.00
R5598:Thsd7b UTSW 1 129595841 missense probably damaging 1.00
R5620:Thsd7b UTSW 1 130162936 critical splice donor site probably null
R5638:Thsd7b UTSW 1 129595533 missense probably benign 0.00
R5640:Thsd7b UTSW 1 130116671 nonsense probably null
R5655:Thsd7b UTSW 1 129628934 synonymous probably null
R5711:Thsd7b UTSW 1 129760402 missense probably damaging 1.00
R5823:Thsd7b UTSW 1 129678084 missense probably benign 0.00
R5888:Thsd7b UTSW 1 130210320 nonsense probably null
R5932:Thsd7b UTSW 1 129430838 missense probably benign
R6243:Thsd7b UTSW 1 130162862 missense probably benign 0.21
R6258:Thsd7b UTSW 1 129667918 missense probably benign
R6260:Thsd7b UTSW 1 129667918 missense probably benign
R6399:Thsd7b UTSW 1 129816648 missense probably benign 0.13
R6437:Thsd7b UTSW 1 129816682 missense probably damaging 1.00
R6719:Thsd7b UTSW 1 130159714 splice site probably null
R6785:Thsd7b UTSW 1 129430907 missense probably damaging 0.99
X0027:Thsd7b UTSW 1 129596072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCCTGAAACTCAGTGATGCTTTG -3'
(R):5'- CAGTCTCCAGATCCCATCAGCATTC -3'

Sequencing Primer
(F):5'- ATTCTGGGGGCATCCTTTCT -3'
(R):5'- CCAGCTtttctttctttctttctttc -3'
Posted On2013-09-30