Incidental Mutation 'R0746:Acvr1'
List |< first << previous [record 53 of 1308] next >> last >|
ID70117
Institutional Source Beutler Lab
Gene Symbol Acvr1
Ensembl Gene ENSMUSG00000026836
Gene Nameactivin A receptor, type 1
SynonymsAlk-2, ActR-I, Acvrlk2, SKR1, ALK2, Tsk7L, D330013D15Rik, Acvr, ActRIA, Alk8
MMRRC Submission 038927-MU
Accession Numbers

Genbank: NM_007394; MGI: 87911

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0746 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location58388644-58567157 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 58500550 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000120755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056376] [ENSMUST00000090935] [ENSMUST00000112599] [ENSMUST00000112601] [ENSMUST00000126407]
Predicted Effect probably null
Transcript: ENSMUST00000056376
AA Change: M1V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056784
Gene: ENSMUSG00000026836
AA Change: M1V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000090935
AA Change: M1V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088453
Gene: ENSMUSG00000026836
AA Change: M1V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000112599
AA Change: M1V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108218
Gene: ENSMUSG00000026836
AA Change: M1V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 1.4e-13 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000112601
AA Change: M1V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108220
Gene: ENSMUSG00000026836
AA Change: M1V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000126407
AA Change: M1V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000120755
Gene: ENSMUSG00000026836
AA Change: M1V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 3.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145495
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I ( I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. This gene encodes activin A type I receptor which signals a particular transcriptional response in concert with activin type II receptors. Mutations in this gene are associated with fibrodysplasia ossificans progressive. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth arrest and complete embryonic lethality due to gastrulation defects associated with abnormalities in primitive streak formation, embryonic epiblast morphology, and mesoderm and ectoderm development. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(5)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik T C 17: 79,628,286 probably benign Het
Adamts10 T A 17: 33,549,547 C866* probably null Het
Adgrv1 G A 13: 81,570,556 P4S probably benign Het
Arhgef37 A G 18: 61,517,993 probably null Het
Arid4b A G 13: 14,143,038 T169A probably benign Het
Cabp7 A T 11: 4,738,900 I190N probably damaging Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Ces1d A G 8: 93,189,468 F177S probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Csmd2 T A 4: 128,414,297 C1283S probably damaging Het
Cul1 T C 6: 47,518,288 probably null Het
F7 T G 8: 13,034,740 S255R probably benign Het
Fanci T A 7: 79,439,681 I955N probably damaging Het
Focad C A 4: 88,397,214 D1536E possibly damaging Het
Fus A G 7: 127,985,424 probably benign Het
Gpr146 C T 5: 139,393,222 R260W probably damaging Het
Grid1 T C 14: 34,822,690 F73L possibly damaging Het
Ilf2 T A 3: 90,482,807 V142D probably damaging Het
Kcna2 A G 3: 107,105,168 D355G probably benign Het
Mgat4c T C 10: 102,388,687 F254S probably damaging Het
Mrps10 A C 17: 47,372,639 R139S probably benign Het
Myh2 A G 11: 67,173,431 T71A probably benign Het
Myo1d A C 11: 80,586,879 Y893D possibly damaging Het
Ncapd2 T C 6: 125,174,264 E760G possibly damaging Het
Olfr509 A T 7: 108,646,041 D178E probably damaging Het
Olfr745 T A 14: 50,642,775 probably null Het
Pkhd1 T A 1: 20,198,107 D3349V probably damaging Het
Ptprn2 A C 12: 116,901,017 M551L probably benign Het
Ptprq A G 10: 107,517,831 Y2275H probably damaging Het
Rfx7 A G 9: 72,619,106 T1193A probably benign Het
Rtl1 T C 12: 109,592,960 D815G probably damaging Het
Scn1a T A 2: 66,351,126 T18S probably benign Het
Sept5 T C 16: 18,623,225 H277R probably damaging Het
Sh3bp5l A G 11: 58,346,347 S377G probably benign Het
Snx2 T A 18: 53,197,889 I142K possibly damaging Het
Spata31d1a C A 13: 59,702,263 D684Y possibly damaging Het
Taar6 C A 10: 23,985,360 S96I probably benign Het
Thsd7b C A 1: 130,188,531 H1340Q probably benign Het
Tmem115 C T 9: 107,537,999 T329M probably benign Het
Tmem50b C T 16: 91,581,690 probably null Het
Uhrf1bp1l T A 10: 89,805,454 I829K probably benign Het
Wdr64 A T 1: 175,792,973 D316V possibly damaging Het
Yars C A 4: 129,197,286 S162R probably damaging Het
Other mutations in Acvr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Acvr1 APN 2 58447573 missense probably benign 0.00
IGL01392:Acvr1 APN 2 58500546 missense probably benign 0.01
IGL01526:Acvr1 APN 2 58458985 missense probably benign 0.20
IGL02524:Acvr1 APN 2 58448307 splice site probably benign
IGL02682:Acvr1 APN 2 58477811 missense probably benign 0.00
IGL02795:Acvr1 APN 2 58462952 missense probably damaging 1.00
R0084:Acvr1 UTSW 2 58458883 critical splice donor site probably null
R0452:Acvr1 UTSW 2 58500495 missense probably benign 0.13
R1484:Acvr1 UTSW 2 58479889 missense probably damaging 1.00
R1514:Acvr1 UTSW 2 58447585 nonsense probably null
R1645:Acvr1 UTSW 2 58462899 missense probably damaging 1.00
R1925:Acvr1 UTSW 2 58447649 missense probably damaging 0.99
R2435:Acvr1 UTSW 2 58479692 missense probably damaging 1.00
R2873:Acvr1 UTSW 2 58477796 nonsense probably null
R3729:Acvr1 UTSW 2 58462913 missense probably null 0.09
R3854:Acvr1 UTSW 2 58462934 missense probably damaging 1.00
R4438:Acvr1 UTSW 2 58477727 missense probably benign 0.00
R4863:Acvr1 UTSW 2 58477711 missense possibly damaging 0.60
R5543:Acvr1 UTSW 2 58463145 missense probably damaging 1.00
R5558:Acvr1 UTSW 2 58459017 missense probably damaging 1.00
R5618:Acvr1 UTSW 2 58462943 missense probably damaging 1.00
R6233:Acvr1 UTSW 2 58448399 missense probably benign 0.04
R6236:Acvr1 UTSW 2 58477666 missense probably benign 0.17
R6565:Acvr1 UTSW 2 58479757 missense probably damaging 1.00
R6912:Acvr1 UTSW 2 58447573 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCTCCGAGTACATTTGTTTGCAC -3'
(R):5'- GCTCAGAGATACAGCCAGTAGAGGTC -3'

Sequencing Primer
(F):5'- gcacattaaagcagtcaaggg -3'
(R):5'- TTTGGCCAGAGGGAAGTCTT -3'
Posted On2013-09-30