Incidental Mutation 'R0746:Septin5'
ID 70154
Institutional Source Beutler Lab
Gene Symbol Septin5
Ensembl Gene ENSMUSG00000072214
Gene Name septin 5
Synonyms Cdcrel1, Pnutl1, Sept5
MMRRC Submission 038927-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.409) question?
Stock # R0746 (G1)
Quality Score 205
Status Not validated
Chromosome 16
Chromosomal Location 18440561-18448688 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18441975 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 277 (H277R)
Ref Sequence ENSEMBL: ENSMUSP00000094750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051160] [ENSMUST00000096987] [ENSMUST00000167388] [ENSMUST00000231244] [ENSMUST00000231335] [ENSMUST00000231956] [ENSMUST00000232653] [ENSMUST00000231622]
AlphaFold Q9Z2Q6
Predicted Effect probably benign
Transcript: ENSMUST00000051160
SMART Domains Protein: ENSMUSP00000059270
Gene: ENSMUSG00000050761

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
LRRNT 33 67 4.14e-11 SMART
low complexity region 75 94 N/A INTRINSIC
LRRCT 97 150 4.88e-14 SMART
transmembrane domain 159 181 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000096987
AA Change: H277R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094750
Gene: ENSMUSG00000072214
AA Change: H277R

DomainStartEndE-ValueType
Pfam:Septin 41 321 1.2e-127 PFAM
Pfam:MMR_HSR1 46 190 5.1e-7 PFAM
low complexity region 355 369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167388
SMART Domains Protein: ENSMUSP00000126292
Gene: ENSMUSG00000050761

DomainStartEndE-ValueType
LRRNT 25 59 4.14e-11 SMART
low complexity region 67 86 N/A INTRINSIC
LRRCT 89 142 4.88e-14 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000231244
AA Change: T245A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231246
Predicted Effect probably damaging
Transcript: ENSMUST00000231335
AA Change: H286R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000231956
AA Change: H289R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000232653
AA Change: H286R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000231622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231400
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene show no gross phenotypic changes. Partial defects in synaptic transmission is reported for one allele, and platelet secretion and modest behavioral defects reported for a different allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik T C 17: 79,935,715 (GRCm39) probably benign Het
Acvr1 T C 2: 58,390,562 (GRCm39) M1V probably null Het
Adamts10 T A 17: 33,768,521 (GRCm39) C866* probably null Het
Adgrv1 G A 13: 81,718,675 (GRCm39) P4S probably benign Het
Arhgef37 A G 18: 61,651,064 (GRCm39) probably null Het
Arid4b A G 13: 14,317,623 (GRCm39) T169A probably benign Het
Bltp3b T A 10: 89,641,316 (GRCm39) I829K probably benign Het
Cabp7 A T 11: 4,688,900 (GRCm39) I190N probably damaging Het
Capn13 A C 17: 73,658,503 (GRCm39) D188E probably benign Het
Ces1d A G 8: 93,916,096 (GRCm39) F177S probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Csmd2 T A 4: 128,308,090 (GRCm39) C1283S probably damaging Het
Cul1 T C 6: 47,495,222 (GRCm39) probably null Het
F7 T G 8: 13,084,740 (GRCm39) S255R probably benign Het
Fanci T A 7: 79,089,429 (GRCm39) I955N probably damaging Het
Focad C A 4: 88,315,451 (GRCm39) D1536E possibly damaging Het
Fus A G 7: 127,584,596 (GRCm39) probably benign Het
Gpr146 C T 5: 139,378,977 (GRCm39) R260W probably damaging Het
Grid1 T C 14: 34,544,647 (GRCm39) F73L possibly damaging Het
Ilf2 T A 3: 90,390,114 (GRCm39) V142D probably damaging Het
Kcna2 A G 3: 107,012,484 (GRCm39) D355G probably benign Het
Mgat4c T C 10: 102,224,548 (GRCm39) F254S probably damaging Het
Mrps10 A C 17: 47,683,564 (GRCm39) R139S probably benign Het
Myh2 A G 11: 67,064,257 (GRCm39) T71A probably benign Het
Myo1d A C 11: 80,477,705 (GRCm39) Y893D possibly damaging Het
Ncapd2 T C 6: 125,151,227 (GRCm39) E760G possibly damaging Het
Or10ab5 A T 7: 108,245,248 (GRCm39) D178E probably damaging Het
Or11h6 T A 14: 50,880,232 (GRCm39) probably null Het
Pkhd1 T A 1: 20,268,331 (GRCm39) D3349V probably damaging Het
Ptprn2 A C 12: 116,864,637 (GRCm39) M551L probably benign Het
Ptprq A G 10: 107,353,692 (GRCm39) Y2275H probably damaging Het
Rfx7 A G 9: 72,526,388 (GRCm39) T1193A probably benign Het
Rtl1 T C 12: 109,559,394 (GRCm39) D815G probably damaging Het
Scn1a T A 2: 66,181,470 (GRCm39) T18S probably benign Het
Sh3bp5l A G 11: 58,237,173 (GRCm39) S377G probably benign Het
Snx2 T A 18: 53,330,961 (GRCm39) I142K possibly damaging Het
Spata31d1a C A 13: 59,850,077 (GRCm39) D684Y possibly damaging Het
Taar6 C A 10: 23,861,258 (GRCm39) S96I probably benign Het
Thsd7b C A 1: 130,116,268 (GRCm39) H1340Q probably benign Het
Tmem115 C T 9: 107,415,198 (GRCm39) T329M probably benign Het
Tmem50b C T 16: 91,378,578 (GRCm39) probably null Het
Wdr64 A T 1: 175,620,539 (GRCm39) D316V possibly damaging Het
Yars1 C A 4: 129,091,079 (GRCm39) S162R probably damaging Het
Other mutations in Septin5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Septin5 APN 16 18,443,680 (GRCm39) missense probably damaging 1.00
IGL02124:Septin5 APN 16 18,443,579 (GRCm39) missense probably damaging 0.98
IGL02211:Septin5 APN 16 18,443,629 (GRCm39) missense probably damaging 1.00
IGL02934:Septin5 APN 16 18,448,581 (GRCm39) missense probably damaging 0.99
R0518:Septin5 UTSW 16 18,443,647 (GRCm39) missense probably benign 0.02
R0521:Septin5 UTSW 16 18,443,647 (GRCm39) missense probably benign 0.02
R0627:Septin5 UTSW 16 18,444,115 (GRCm39) missense possibly damaging 0.90
R0891:Septin5 UTSW 16 18,443,595 (GRCm39) missense probably damaging 1.00
R1037:Septin5 UTSW 16 18,441,844 (GRCm39) splice site probably benign
R1850:Septin5 UTSW 16 18,443,960 (GRCm39) missense probably damaging 1.00
R2044:Septin5 UTSW 16 18,441,762 (GRCm39) missense probably benign 0.10
R3872:Septin5 UTSW 16 18,441,723 (GRCm39) missense probably damaging 0.98
R4498:Septin5 UTSW 16 18,442,142 (GRCm39) missense probably damaging 1.00
R5503:Septin5 UTSW 16 18,442,118 (GRCm39) missense probably benign 0.00
R5963:Septin5 UTSW 16 18,442,962 (GRCm39) splice site probably null
R6286:Septin5 UTSW 16 18,442,127 (GRCm39) missense probably damaging 0.99
R7014:Septin5 UTSW 16 18,443,659 (GRCm39) missense probably damaging 1.00
R7909:Septin5 UTSW 16 18,443,372 (GRCm39) missense probably damaging 1.00
R8708:Septin5 UTSW 16 18,443,622 (GRCm39) missense probably benign 0.01
R8888:Septin5 UTSW 16 18,441,861 (GRCm39) missense possibly damaging 0.81
R8895:Septin5 UTSW 16 18,441,861 (GRCm39) missense possibly damaging 0.81
R9210:Septin5 UTSW 16 18,442,961 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCCAGATGAACCCAGGGTGGAATC -3'
(R):5'- CCGTTATTGGCAGCAACACTGTG -3'

Sequencing Primer
(F):5'- GCGACCCAAGTCAGAGTG -3'
(R):5'- CTGTGGTGGAGGCCAAG -3'
Posted On 2013-09-30