Incidental Mutation 'R0747:Iqgap3'
ID70170
Institutional Source Beutler Lab
Gene Symbol Iqgap3
Ensembl Gene ENSMUSG00000028068
Gene NameIQ motif containing GTPase activating protein 3
Synonyms
MMRRC Submission 038928-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R0747 (G1)
Quality Score152
Status Validated
Chromosome3
Chromosomal Location88081971-88121048 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 88107503 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071812] [ENSMUST00000194440] [ENSMUST00000195465]
Predicted Effect probably benign
Transcript: ENSMUST00000071812
SMART Domains Protein: ENSMUSP00000071715
Gene: ENSMUSG00000028068

DomainStartEndE-ValueType
CH 36 145 1.72e-14 SMART
internal_repeat_2 197 249 1.75e-5 PROSPERO
internal_repeat_1 209 418 1.31e-14 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 651 1.31e-14 PROSPERO
internal_repeat_2 600 652 1.75e-5 PROSPERO
IQ 730 752 1.18e1 SMART
IQ 760 782 3.76e-6 SMART
IQ 790 812 3.08e-2 SMART
IQ 820 842 1.72e0 SMART
RasGAP 977 1330 1.74e-57 SMART
Blast:RasGAP 1338 1422 1e-9 BLAST
Pfam:RasGAP_C 1434 1555 2e-36 PFAM
low complexity region 1591 1602 N/A INTRINSIC
low complexity region 1615 1630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194440
SMART Domains Protein: ENSMUSP00000142035
Gene: ENSMUSG00000028068

DomainStartEndE-ValueType
Blast:RasGAP 1 67 3e-30 BLAST
RasGAP 79 432 1e-59 SMART
Blast:RasGAP 440 524 5e-10 BLAST
Pfam:RasGAP_C 535 660 5.7e-30 PFAM
low complexity region 693 704 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194772
Predicted Effect probably benign
Transcript: ENSMUST00000195465
SMART Domains Protein: ENSMUSP00000142013
Gene: ENSMUSG00000028068

DomainStartEndE-ValueType
CH 36 145 8.5e-17 SMART
internal_repeat_1 209 379 1.33e-7 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 612 1.33e-7 PROSPERO
Meta Mutation Damage Score 0.1104 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik T A 14: 12,287,287 M16K probably benign Het
Adam19 A T 11: 46,118,495 probably null Het
Anks4b C T 7: 120,182,163 A139V probably damaging Het
Arf1 G A 11: 59,212,635 R149C probably benign Het
Axl A T 7: 25,764,059 C598S possibly damaging Het
B3gnt2 T C 11: 22,836,316 I291V possibly damaging Het
Ccdc158 T A 5: 92,633,297 H883L probably benign Het
Col6a3 A G 1: 90,802,653 S1644P probably damaging Het
Cspg4 T C 9: 56,890,280 S1343P probably damaging Het
D430041D05Rik G T 2: 104,230,306 H1414Q probably damaging Het
Dnah5 C G 15: 28,444,186 I4043M probably damaging Het
Dnah5 T A 15: 28,444,187 C4044S possibly damaging Het
Dpep3 C T 8: 105,977,386 A267T probably benign Het
Dync1h1 A C 12: 110,612,411 H106P probably benign Het
Dync1h1 A C 12: 110,629,284 E1466A probably damaging Het
Fggy T C 4: 95,812,100 probably benign Het
Frmd6 A G 12: 70,864,056 T5A probably benign Het
Gnb5 G A 9: 75,311,470 V26I probably benign Het
Hephl1 A T 9: 15,054,001 probably benign Het
Hmmr C T 11: 40,721,745 probably benign Het
Hpn A T 7: 31,099,546 F356Y probably damaging Het
Ism2 A G 12: 87,285,398 probably benign Het
Kansl1 T A 11: 104,342,976 M754L probably benign Het
Kcnc4 A T 3: 107,448,154 I326N probably damaging Het
Lcn6 G A 2: 25,677,172 V62M probably damaging Het
Lrp1b A T 2: 40,870,341 C2858S probably damaging Het
Lyn G A 4: 3,745,638 probably benign Het
Mov10 T A 3: 104,802,496 H358L probably benign Het
Notch1 A G 2: 26,472,140 V60A unknown Het
Olfr720 C T 14: 14,175,429 A218T probably benign Het
Pgap2 C A 7: 102,237,136 Y176* probably null Het
Pglyrp1 A G 7: 18,890,275 Q161R possibly damaging Het
Plod3 A G 5: 136,988,195 N66S probably benign Het
Psmc3 A G 2: 91,054,300 E18G probably benign Het
Psme3 T G 11: 101,317,046 M9R probably benign Het
Rapgef4 A G 2: 72,223,073 N428S possibly damaging Het
Rbp3 A G 14: 33,956,278 I728V possibly damaging Het
Sall4 A T 2: 168,754,966 H651Q probably damaging Het
Skint3 T A 4: 112,253,905 Y76N probably damaging Het
Slc13a4 T C 6: 35,278,328 T342A probably damaging Het
Slc25a1 G T 16: 17,926,220 T239K probably damaging Het
Slc36a2 T A 11: 55,169,859 I242F probably benign Het
Tekt2 G A 4: 126,323,760 Q171* probably null Het
Tet2 T G 3: 133,467,470 H1677P possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trcg1 C T 9: 57,241,921 P259S probably benign Het
Ttn A C 2: 76,710,598 S25688A probably damaging Het
Vmn2r117 T A 17: 23,475,503 R457* probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Other mutations in Iqgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Iqgap3 APN 3 88107560 missense probably damaging 1.00
IGL01062:Iqgap3 APN 3 88110122 missense probably benign 0.00
IGL01517:Iqgap3 APN 3 88109396 missense probably benign 0.09
IGL01530:Iqgap3 APN 3 88112303 critical splice acceptor site probably null
IGL01658:Iqgap3 APN 3 88115971 missense possibly damaging 0.89
IGL02027:Iqgap3 APN 3 88087342 missense possibly damaging 0.67
IGL02352:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02359:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02522:Iqgap3 APN 3 88108398 missense possibly damaging 0.94
IGL02717:Iqgap3 APN 3 88098359 missense probably benign 0.01
IGL02971:Iqgap3 APN 3 88090304 missense probably benign 0.30
IGL03079:Iqgap3 APN 3 88113170 missense probably benign
IGL03240:Iqgap3 APN 3 88114974 missense probably benign 0.00
adjutant UTSW 3 88101527 missense possibly damaging 0.51
booster UTSW 3 88113128 missense probably damaging 0.99
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0285:Iqgap3 UTSW 3 88096990 missense probably benign 0.11
R0442:Iqgap3 UTSW 3 88115959 missense probably damaging 0.96
R0490:Iqgap3 UTSW 3 88114056 splice site probably benign
R0569:Iqgap3 UTSW 3 88090725 splice site probably benign
R0843:Iqgap3 UTSW 3 88108431 missense possibly damaging 0.94
R1260:Iqgap3 UTSW 3 88114023 missense probably benign
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1544:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R1662:Iqgap3 UTSW 3 88098401 missense probably benign 0.33
R1686:Iqgap3 UTSW 3 88108356 splice site probably benign
R1748:Iqgap3 UTSW 3 88113980 missense possibly damaging 0.92
R1836:Iqgap3 UTSW 3 88108368 missense probably damaging 1.00
R1972:Iqgap3 UTSW 3 88083928 splice site probably null
R1973:Iqgap3 UTSW 3 88083928 splice site probably null
R2051:Iqgap3 UTSW 3 88120167 missense probably damaging 1.00
R2314:Iqgap3 UTSW 3 88116031 missense probably benign 0.01
R2352:Iqgap3 UTSW 3 88104508 missense possibly damaging 0.94
R2857:Iqgap3 UTSW 3 88107596 nonsense probably null
R2859:Iqgap3 UTSW 3 88107596 nonsense probably null
R3435:Iqgap3 UTSW 3 88094604 missense probably benign 0.00
R3522:Iqgap3 UTSW 3 88090782 missense probably null 0.90
R4281:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4283:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4397:Iqgap3 UTSW 3 88104358 missense probably damaging 1.00
R4414:Iqgap3 UTSW 3 88096986 missense probably benign
R4660:Iqgap3 UTSW 3 88120176 missense probably damaging 1.00
R4872:Iqgap3 UTSW 3 88113128 missense probably damaging 0.99
R4883:Iqgap3 UTSW 3 88107535 missense probably benign
R4915:Iqgap3 UTSW 3 88101527 missense possibly damaging 0.51
R5050:Iqgap3 UTSW 3 88090186 missense probably damaging 1.00
R5130:Iqgap3 UTSW 3 88108854 missense probably damaging 0.97
R5151:Iqgap3 UTSW 3 88117760 missense possibly damaging 0.58
R5645:Iqgap3 UTSW 3 88117699 missense probably damaging 1.00
R5706:Iqgap3 UTSW 3 88115908 missense probably benign 0.03
R5748:Iqgap3 UTSW 3 88109370 missense probably damaging 1.00
R5880:Iqgap3 UTSW 3 88117202 missense possibly damaging 0.67
R5982:Iqgap3 UTSW 3 88091592 nonsense probably null
R6006:Iqgap3 UTSW 3 88091547 missense probably damaging 0.98
R6026:Iqgap3 UTSW 3 88090171 missense probably damaging 1.00
R6188:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R6211:Iqgap3 UTSW 3 88091515 missense probably benign
R6291:Iqgap3 UTSW 3 88089730 critical splice donor site probably null
R6344:Iqgap3 UTSW 3 88082094 critical splice donor site probably null
R6854:Iqgap3 UTSW 3 88096951 missense probably damaging 1.00
R6875:Iqgap3 UTSW 3 88112771 frame shift probably null
R6877:Iqgap3 UTSW 3 88112771 frame shift probably null
R6958:Iqgap3 UTSW 3 88113366 missense possibly damaging 0.89
R7008:Iqgap3 UTSW 3 88112771 frame shift probably null
R7050:Iqgap3 UTSW 3 88098913 missense probably damaging 1.00
R7144:Iqgap3 UTSW 3 88116910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCTCACAGGTGCTACATGCAG -3'
(R):5'- ACGAGCAGACCAATCTTGATGTCC -3'

Sequencing Primer
(F):5'- CTATGTGGTAGACGACAGGC -3'
(R):5'- GACCAATCTTGATGTCCATGAGG -3'
Posted On2013-09-30