Incidental Mutation 'R0747:Pglyrp1'
ID70182
Institutional Source Beutler Lab
Gene Symbol Pglyrp1
Ensembl Gene ENSMUSG00000030413
Gene Namepeptidoglycan recognition protein 1
SynonymsPGRP-S, Tnfsf3l, peptidoglycan recognition protein, Tag7, Tasg7
MMRRC Submission 038928-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R0747 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location18871331-18890459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18890275 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 161 (Q161R)
Ref Sequence ENSEMBL: ENSMUSP00000032573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032573] [ENSMUST00000098780] [ENSMUST00000133506] [ENSMUST00000135467]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032573
AA Change: Q161R

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032573
Gene: ENSMUSG00000030413
AA Change: Q161R

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PGRP 18 161 8.93e-75 SMART
Ami_2 29 167 5.11e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098780
SMART Domains Protein: ENSMUSP00000096377
Gene: ENSMUSG00000074358

DomainStartEndE-ValueType
coiled coil region 173 206 N/A INTRINSIC
low complexity region 217 242 N/A INTRINSIC
coiled coil region 243 280 N/A INTRINSIC
low complexity region 290 332 N/A INTRINSIC
low complexity region 350 383 N/A INTRINSIC
low complexity region 400 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133506
SMART Domains Protein: ENSMUSP00000123152
Gene: ENSMUSG00000074358

DomainStartEndE-ValueType
low complexity region 28 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206481
Predicted Effect probably benign
Transcript: ENSMUST00000206499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206595
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Homozygous mutant mice show a defect in neutrophil killing and increased susceptibility to infection with non-pathogenic gram-positive bacteria or DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik T A 14: 12,287,287 M16K probably benign Het
Adam19 A T 11: 46,118,495 probably null Het
Anks4b C T 7: 120,182,163 A139V probably damaging Het
Arf1 G A 11: 59,212,635 R149C probably benign Het
Axl A T 7: 25,764,059 C598S possibly damaging Het
B3gnt2 T C 11: 22,836,316 I291V possibly damaging Het
Ccdc158 T A 5: 92,633,297 H883L probably benign Het
Col6a3 A G 1: 90,802,653 S1644P probably damaging Het
Cspg4 T C 9: 56,890,280 S1343P probably damaging Het
D430041D05Rik G T 2: 104,230,306 H1414Q probably damaging Het
Dnah5 C G 15: 28,444,186 I4043M probably damaging Het
Dnah5 T A 15: 28,444,187 C4044S possibly damaging Het
Dpep3 C T 8: 105,977,386 A267T probably benign Het
Dync1h1 A C 12: 110,612,411 H106P probably benign Het
Dync1h1 A C 12: 110,629,284 E1466A probably damaging Het
Fggy T C 4: 95,812,100 probably benign Het
Frmd6 A G 12: 70,864,056 T5A probably benign Het
Gnb5 G A 9: 75,311,470 V26I probably benign Het
Hephl1 A T 9: 15,054,001 probably benign Het
Hmmr C T 11: 40,721,745 probably benign Het
Hpn A T 7: 31,099,546 F356Y probably damaging Het
Iqgap3 T C 3: 88,107,503 probably benign Het
Ism2 A G 12: 87,285,398 probably benign Het
Kansl1 T A 11: 104,342,976 M754L probably benign Het
Kcnc4 A T 3: 107,448,154 I326N probably damaging Het
Lcn6 G A 2: 25,677,172 V62M probably damaging Het
Lrp1b A T 2: 40,870,341 C2858S probably damaging Het
Lyn G A 4: 3,745,638 probably benign Het
Mov10 T A 3: 104,802,496 H358L probably benign Het
Notch1 A G 2: 26,472,140 V60A unknown Het
Olfr720 C T 14: 14,175,429 A218T probably benign Het
Pgap2 C A 7: 102,237,136 Y176* probably null Het
Plod3 A G 5: 136,988,195 N66S probably benign Het
Psmc3 A G 2: 91,054,300 E18G probably benign Het
Psme3 T G 11: 101,317,046 M9R probably benign Het
Rapgef4 A G 2: 72,223,073 N428S possibly damaging Het
Rbp3 A G 14: 33,956,278 I728V possibly damaging Het
Sall4 A T 2: 168,754,966 H651Q probably damaging Het
Skint3 T A 4: 112,253,905 Y76N probably damaging Het
Slc13a4 T C 6: 35,278,328 T342A probably damaging Het
Slc25a1 G T 16: 17,926,220 T239K probably damaging Het
Slc36a2 T A 11: 55,169,859 I242F probably benign Het
Tekt2 G A 4: 126,323,760 Q171* probably null Het
Tet2 T G 3: 133,467,470 H1677P possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trcg1 C T 9: 57,241,921 P259S probably benign Het
Ttn A C 2: 76,710,598 S25688A probably damaging Het
Vmn2r117 T A 17: 23,475,503 R457* probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Other mutations in Pglyrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0049:Pglyrp1 UTSW 7 18889388 missense probably damaging 1.00
R0049:Pglyrp1 UTSW 7 18889388 missense probably damaging 1.00
R1687:Pglyrp1 UTSW 7 18884704 start gained probably benign
R1900:Pglyrp1 UTSW 7 18890226 missense probably damaging 1.00
R4696:Pglyrp1 UTSW 7 18884946 missense probably benign 0.42
R4903:Pglyrp1 UTSW 7 18890203 missense probably benign 0.01
R5953:Pglyrp1 UTSW 7 18890313 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTGTGTGGACAGACCCAGCG -3'
(R):5'- GGTTTTCCTGCACCAGTGAGGATG -3'

Sequencing Primer
(F):5'- aactatttatctcccacagccc -3'
(R):5'- TCGGTAGTGTTCCCAGCTTT -3'
Posted On2013-09-30