Incidental Mutation 'R0747:Pgap2'
ID70185
Institutional Source Beutler Lab
Gene Symbol Pgap2
Ensembl Gene ENSMUSG00000030990
Gene Namepost-GPI attachment to proteins 2
Synonyms1810006G21Rik, Frag1
MMRRC Submission 038928-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0747 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102210208-102238567 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 102237136 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 176 (Y176*)
Ref Sequence ENSEMBL: ENSMUSP00000121521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033292] [ENSMUST00000098230] [ENSMUST00000106923] [ENSMUST00000119816] [ENSMUST00000120119] [ENSMUST00000120879] [ENSMUST00000126914] [ENSMUST00000129340] [ENSMUST00000138479] [ENSMUST00000138753] [ENSMUST00000140058] [ENSMUST00000142873] [ENSMUST00000143541] [ENSMUST00000145352] [ENSMUST00000153020] [ENSMUST00000156529] [ENSMUST00000209968]
Predicted Effect probably null
Transcript: ENSMUST00000033292
AA Change: Y180*
SMART Domains Protein: ENSMUSP00000033292
Gene: ENSMUSG00000030990
AA Change: Y180*

DomainStartEndE-ValueType
Pfam:Frag1 18 241 2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098230
SMART Domains Protein: ENSMUSP00000095832
Gene: ENSMUSG00000073982

DomainStartEndE-ValueType
RHO 6 179 1.87e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106923
SMART Domains Protein: ENSMUSP00000102536
Gene: ENSMUSG00000073982

DomainStartEndE-ValueType
RHO 6 179 1.87e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119816
SMART Domains Protein: ENSMUSP00000113261
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120119
AA Change: Y178*
SMART Domains Protein: ENSMUSP00000113574
Gene: ENSMUSG00000030990
AA Change: Y178*

DomainStartEndE-ValueType
Pfam:Frag1 16 239 1.6e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120879
AA Change: Y176*
SMART Domains Protein: ENSMUSP00000114016
Gene: ENSMUSG00000030990
AA Change: Y176*

DomainStartEndE-ValueType
Pfam:Frag1 18 237 7.2e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126914
SMART Domains Protein: ENSMUSP00000114853
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 101 6.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127804
Predicted Effect probably benign
Transcript: ENSMUST00000129340
SMART Domains Protein: ENSMUSP00000119692
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134621
Predicted Effect probably null
Transcript: ENSMUST00000137303
AA Change: Y127*
Predicted Effect probably null
Transcript: ENSMUST00000138479
AA Change: Y180*
SMART Domains Protein: ENSMUSP00000115590
Gene: ENSMUSG00000030990
AA Change: Y180*

DomainStartEndE-ValueType
Pfam:Frag1 18 209 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138753
SMART Domains Protein: ENSMUSP00000116858
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 123 9.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140058
SMART Domains Protein: ENSMUSP00000122482
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142873
SMART Domains Protein: ENSMUSP00000121988
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 136 3.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143541
SMART Domains Protein: ENSMUSP00000117450
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 79 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143759
Predicted Effect probably benign
Transcript: ENSMUST00000145352
SMART Domains Protein: ENSMUSP00000123523
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150891
Predicted Effect probably null
Transcript: ENSMUST00000153020
AA Change: Y180*
SMART Domains Protein: ENSMUSP00000123570
Gene: ENSMUSG00000030990
AA Change: Y180*

DomainStartEndE-ValueType
Pfam:Frag1 18 209 5.9e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156529
AA Change: Y176*
SMART Domains Protein: ENSMUSP00000121521
Gene: ENSMUSG00000030990
AA Change: Y176*

DomainStartEndE-ValueType
Pfam:Frag1 18 237 7.2e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214560
Meta Mutation Damage Score 0.534 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik T A 14: 12,287,287 M16K probably benign Het
Adam19 A T 11: 46,118,495 probably null Het
Anks4b C T 7: 120,182,163 A139V probably damaging Het
Arf1 G A 11: 59,212,635 R149C probably benign Het
Axl A T 7: 25,764,059 C598S possibly damaging Het
B3gnt2 T C 11: 22,836,316 I291V possibly damaging Het
Ccdc158 T A 5: 92,633,297 H883L probably benign Het
Col6a3 A G 1: 90,802,653 S1644P probably damaging Het
Cspg4 T C 9: 56,890,280 S1343P probably damaging Het
D430041D05Rik G T 2: 104,230,306 H1414Q probably damaging Het
Dnah5 C G 15: 28,444,186 I4043M probably damaging Het
Dnah5 T A 15: 28,444,187 C4044S possibly damaging Het
Dpep3 C T 8: 105,977,386 A267T probably benign Het
Dync1h1 A C 12: 110,612,411 H106P probably benign Het
Dync1h1 A C 12: 110,629,284 E1466A probably damaging Het
Fggy T C 4: 95,812,100 probably benign Het
Frmd6 A G 12: 70,864,056 T5A probably benign Het
Gnb5 G A 9: 75,311,470 V26I probably benign Het
Hephl1 A T 9: 15,054,001 probably benign Het
Hmmr C T 11: 40,721,745 probably benign Het
Hpn A T 7: 31,099,546 F356Y probably damaging Het
Iqgap3 T C 3: 88,107,503 probably benign Het
Ism2 A G 12: 87,285,398 probably benign Het
Kansl1 T A 11: 104,342,976 M754L probably benign Het
Kcnc4 A T 3: 107,448,154 I326N probably damaging Het
Lcn6 G A 2: 25,677,172 V62M probably damaging Het
Lrp1b A T 2: 40,870,341 C2858S probably damaging Het
Lyn G A 4: 3,745,638 probably benign Het
Mov10 T A 3: 104,802,496 H358L probably benign Het
Notch1 A G 2: 26,472,140 V60A unknown Het
Olfr720 C T 14: 14,175,429 A218T probably benign Het
Pglyrp1 A G 7: 18,890,275 Q161R possibly damaging Het
Plod3 A G 5: 136,988,195 N66S probably benign Het
Psmc3 A G 2: 91,054,300 E18G probably benign Het
Psme3 T G 11: 101,317,046 M9R probably benign Het
Rapgef4 A G 2: 72,223,073 N428S possibly damaging Het
Rbp3 A G 14: 33,956,278 I728V possibly damaging Het
Sall4 A T 2: 168,754,966 H651Q probably damaging Het
Skint3 T A 4: 112,253,905 Y76N probably damaging Het
Slc13a4 T C 6: 35,278,328 T342A probably damaging Het
Slc25a1 G T 16: 17,926,220 T239K probably damaging Het
Slc36a2 T A 11: 55,169,859 I242F probably benign Het
Tekt2 G A 4: 126,323,760 Q171* probably null Het
Tet2 T G 3: 133,467,470 H1677P possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trcg1 C T 9: 57,241,921 P259S probably benign Het
Ttn A C 2: 76,710,598 S25688A probably damaging Het
Vmn2r117 T A 17: 23,475,503 R457* probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Other mutations in Pgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Pgap2 APN 7 102226454 splice site probably benign
IGL01363:Pgap2 APN 7 102226282 start codon destroyed probably null 1.00
IGL02352:Pgap2 APN 7 102236139 missense probably damaging 1.00
IGL02359:Pgap2 APN 7 102236139 missense probably damaging 1.00
IGL02638:Pgap2 APN 7 102237422 missense probably damaging 1.00
IGL03097:Pgap2 UTSW 7 102236227 missense probably damaging 1.00
PIT4131001:Pgap2 UTSW 7 102237198 missense possibly damaging 0.45
R0452:Pgap2 UTSW 7 102236462 missense probably damaging 1.00
R0840:Pgap2 UTSW 7 102237448 missense probably damaging 0.96
R4551:Pgap2 UTSW 7 102226467 intron probably benign
R5122:Pgap2 UTSW 7 102231391 missense probably damaging 1.00
R6440:Pgap2 UTSW 7 102237387 splice site probably null
R7358:Pgap2 UTSW 7 102210567 unclassified probably benign
R7405:Pgap2 UTSW 7 102231388 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCCCACAGAACCTGAAAGTGTTG -3'
(R):5'- AAACCACCCCGTTGCTCTGAAGTC -3'

Sequencing Primer
(F):5'- CAGAACCTGAAAGTGTTGGGTTG -3'
(R):5'- GCTCTGAAGTCACTCATTTACAG -3'
Posted On2013-09-30