Incidental Mutation 'R0747:Kansl1'
ID70197
Institutional Source Beutler Lab
Gene Symbol Kansl1
Ensembl Gene ENSMUSG00000018412
Gene NameKAT8 regulatory NSL complex subunit 1
Synonyms1700081L11Rik
MMRRC Submission 038928-MU
Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0747 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104333229-104468861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104342976 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 754 (M754L)
Ref Sequence ENSEMBL: ENSMUSP00000102585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977]
Predicted Effect probably benign
Transcript: ENSMUST00000018556
SMART Domains Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069188
Predicted Effect probably benign
Transcript: ENSMUST00000106971
AA Change: M754L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: M754L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106972
AA Change: M754L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: M754L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 822 835 N/A INTRINSIC
PEHE 879 1029 1.53e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106977
SMART Domains Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
coiled coil region 283 311 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 759 772 N/A INTRINSIC
PEHE 816 966 1.53e-53 SMART
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]
Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik T A 14: 12,287,287 M16K probably benign Het
Adam19 A T 11: 46,118,495 probably null Het
Anks4b C T 7: 120,182,163 A139V probably damaging Het
Arf1 G A 11: 59,212,635 R149C probably benign Het
Axl A T 7: 25,764,059 C598S possibly damaging Het
B3gnt2 T C 11: 22,836,316 I291V possibly damaging Het
Ccdc158 T A 5: 92,633,297 H883L probably benign Het
Col6a3 A G 1: 90,802,653 S1644P probably damaging Het
Cspg4 T C 9: 56,890,280 S1343P probably damaging Het
D430041D05Rik G T 2: 104,230,306 H1414Q probably damaging Het
Dnah5 C G 15: 28,444,186 I4043M probably damaging Het
Dnah5 T A 15: 28,444,187 C4044S possibly damaging Het
Dpep3 C T 8: 105,977,386 A267T probably benign Het
Dync1h1 A C 12: 110,612,411 H106P probably benign Het
Dync1h1 A C 12: 110,629,284 E1466A probably damaging Het
Fggy T C 4: 95,812,100 probably benign Het
Frmd6 A G 12: 70,864,056 T5A probably benign Het
Gnb5 G A 9: 75,311,470 V26I probably benign Het
Hephl1 A T 9: 15,054,001 probably benign Het
Hmmr C T 11: 40,721,745 probably benign Het
Hpn A T 7: 31,099,546 F356Y probably damaging Het
Iqgap3 T C 3: 88,107,503 probably benign Het
Ism2 A G 12: 87,285,398 probably benign Het
Kcnc4 A T 3: 107,448,154 I326N probably damaging Het
Lcn6 G A 2: 25,677,172 V62M probably damaging Het
Lrp1b A T 2: 40,870,341 C2858S probably damaging Het
Lyn G A 4: 3,745,638 probably benign Het
Mov10 T A 3: 104,802,496 H358L probably benign Het
Notch1 A G 2: 26,472,140 V60A unknown Het
Olfr720 C T 14: 14,175,429 A218T probably benign Het
Pgap2 C A 7: 102,237,136 Y176* probably null Het
Pglyrp1 A G 7: 18,890,275 Q161R possibly damaging Het
Plod3 A G 5: 136,988,195 N66S probably benign Het
Psmc3 A G 2: 91,054,300 E18G probably benign Het
Psme3 T G 11: 101,317,046 M9R probably benign Het
Rapgef4 A G 2: 72,223,073 N428S possibly damaging Het
Rbp3 A G 14: 33,956,278 I728V possibly damaging Het
Sall4 A T 2: 168,754,966 H651Q probably damaging Het
Skint3 T A 4: 112,253,905 Y76N probably damaging Het
Slc13a4 T C 6: 35,278,328 T342A probably damaging Het
Slc25a1 G T 16: 17,926,220 T239K probably damaging Het
Slc36a2 T A 11: 55,169,859 I242F probably benign Het
Tekt2 G A 4: 126,323,760 Q171* probably null Het
Tet2 T G 3: 133,467,470 H1677P possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trcg1 C T 9: 57,241,921 P259S probably benign Het
Ttn A C 2: 76,710,598 S25688A probably damaging Het
Vmn2r117 T A 17: 23,475,503 R457* probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Other mutations in Kansl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Kansl1 APN 11 104424466 missense probably damaging 0.96
IGL00658:Kansl1 APN 11 104357526 missense probably benign 0.10
IGL00688:Kansl1 APN 11 104425066 missense probably damaging 1.00
IGL01121:Kansl1 APN 11 104335596 missense probably benign 0.01
IGL01624:Kansl1 APN 11 104424552 missense probably benign 0.13
IGL02187:Kansl1 APN 11 104378831 splice site probably null
IGL02711:Kansl1 APN 11 104335575 missense probably damaging 1.00
IGL02965:Kansl1 APN 11 104335165 missense probably damaging 0.99
kansas UTSW 11 104424132 missense possibly damaging 0.94
wichita UTSW 11 104356767 missense possibly damaging 0.90
NA:Kansl1 UTSW 11 104342367 missense probably benign 0.09
R0399:Kansl1 UTSW 11 104424132 missense possibly damaging 0.94
R0611:Kansl1 UTSW 11 104338186 missense probably benign 0.31
R0665:Kansl1 UTSW 11 104343538 missense probably benign
R0667:Kansl1 UTSW 11 104343538 missense probably benign
R0865:Kansl1 UTSW 11 104424368 missense probably benign 0.08
R1479:Kansl1 UTSW 11 104342416 missense probably damaging 1.00
R1679:Kansl1 UTSW 11 104423996 missense probably damaging 1.00
R1818:Kansl1 UTSW 11 104342457 missense possibly damaging 0.80
R1922:Kansl1 UTSW 11 104343640 missense probably damaging 1.00
R1932:Kansl1 UTSW 11 104335097 missense probably damaging 0.99
R2105:Kansl1 UTSW 11 104335559 missense probably damaging 0.98
R2907:Kansl1 UTSW 11 104424460 missense possibly damaging 0.82
R3935:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R3936:Kansl1 UTSW 11 104343543 missense possibly damaging 0.83
R4282:Kansl1 UTSW 11 104378689 missense probably benign 0.19
R4455:Kansl1 UTSW 11 104424358 missense possibly damaging 0.47
R4696:Kansl1 UTSW 11 104356767 missense possibly damaging 0.90
R4846:Kansl1 UTSW 11 104342972 missense possibly damaging 0.48
R4890:Kansl1 UTSW 11 104343042 missense probably benign
R4973:Kansl1 UTSW 11 104424321 missense probably damaging 1.00
R4975:Kansl1 UTSW 11 104335564 missense probably damaging 1.00
R5085:Kansl1 UTSW 11 104424342 missense probably damaging 1.00
R5227:Kansl1 UTSW 11 104356814 missense probably benign 0.19
R5310:Kansl1 UTSW 11 104424858 missense possibly damaging 0.95
R5652:Kansl1 UTSW 11 104338166 missense probably damaging 1.00
R5677:Kansl1 UTSW 11 104335148 missense probably benign 0.00
R5980:Kansl1 UTSW 11 104343637 missense possibly damaging 0.96
R6013:Kansl1 UTSW 11 104350639 missense probably benign 0.00
R6253:Kansl1 UTSW 11 104357526 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAGCAACAGTGACCCTGCTATGCC -3'
(R):5'- ATCCTGCTGCCCTGAGTATATAGCC -3'

Sequencing Primer
(F):5'- GCCTTTCTAGCAAGTGATGGAC -3'
(R):5'- GCCCTGAGTATATAGCCTTAGGAG -3'
Posted On2013-09-30