Mutagenetix > Incidental Mutations

Incidental Mutation 'R0748:Sacs'

70233

Institutional Source

Beutler Lab

Gene Symbol

Sacs

Ensembl Gene

ENSMUSG00000048279

Gene Name

sacsin

Synonyms

E130115J16Rik

Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene?

Possibly non essential (E-score: 0.394) question?

Stock #

R0748 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61138457-61240695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 61209265 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 2920 (I2920T)

Ref Sequence

ENSEMBL: ENSMUSP00000113377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119943]

Predicted Effect

probably benign
Transcript: ENSMUST00000089394

SMART Domains

Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

Domain	Start	End	E-Value	Type
SCOP:d1lm8b_	8	66	3e-3	SMART
Blast:UBQ	9	81	3e-31	BLAST
Blast:HATPase_c	116	211	2e-10	BLAST
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119943
AA Change: I2920T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: I2920T

Domain	Start	End	E-Value	Type
internal_repeat_1	61	514	1.35e-52	PROSPERO
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC
low complexity region	1019	1033	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1526	1537	N/A	INTRINSIC
low complexity region	2454	2463	N/A	INTRINSIC
internal_repeat_1	2475	2934	1.35e-52	PROSPERO
low complexity region	3751	3760	N/A	INTRINSIC
low complexity region	3997	4012	N/A	INTRINSIC
low complexity region	4285	4300	N/A	INTRINSIC
Blast:DnaJ	4304	4363	1e-31	BLAST
PDB:1IUR\|A	4309	4376	5e-39	PDB
SCOP:d1gh6a_	4317	4407	2e-3	SMART
HEPN	4454	4570	9.49e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150222

Meta Mutation Damage Score

0.196

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 92.4%

Validation Efficiency

100% (36/36)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf3	A	G	5: 30,196,876	V718A	probably damaging	Het
Amigo1	A	G	3: 108,188,630	S482G	probably damaging	Het
F2rl3	A	G	8: 72,762,751	Q202R	probably benign	Het
Faap100	A	G	11: 120,372,171	V787A	probably damaging	Het
Fat4	A	T	3: 38,887,828	Q290L	possibly damaging	Het
Flnc	A	G	6: 29,446,344	E920G	probably damaging	Het
Gm9881	T	C	16: 91,170,425	N137S	unknown	Het
Hps4	A	G	5: 112,374,914	E546G	probably damaging	Het
Htr2b	A	G	1: 86,110,806	I26T	probably benign	Het
Insr	A	C	8: 3,258,841	M65R	probably damaging	Het
Kif20a	T	C	18: 34,628,188		probably benign	Het
L3mbtl1	A	T	2: 162,971,163		probably benign	Het
L3mbtl1	A	C	2: 162,971,164		probably null	Het
Lcn4	T	C	2: 26,668,347	I175M	probably damaging	Het
Malt1	T	A	18: 65,475,260		probably null	Het
Nufip1	T	C	14: 76,111,068	S46P	probably damaging	Het
Nup93	T	A	8: 94,307,943	Y629N	probably damaging	Het
Olfr517	C	A	7: 108,869,150	M1I	probably null	Het
Pcsk6	T	C	7: 66,038,968		probably benign	Het
Rdx	G	C	9: 52,064,860	V33L	possibly damaging	Het
Rnf213	T	C	11: 119,473,480	L4535P	probably damaging	Het
Rorb	T	A	19: 18,977,800	T66S	probably damaging	Het
S100a9	T	C	3: 90,692,891	D66G	possibly damaging	Het
Safb2	T	C	17: 56,575,580	N351S	probably benign	Het
Ugt1a10	C	T	1: 88,215,123	P113L	probably damaging	Het
Unc13b	G	A	4: 43,241,164		probably benign	Het
Vars	A	G	17: 34,998,012	S489P	probably damaging	Het
Wars2	A	G	3: 99,216,572	K250E	probably damaging	Het
Zfp292	A	G	4: 34,816,424		probably benign	Het

Other mutations in Sacs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Sacs	APN	14	61191635	missense	possibly damaging	0.64
IGL01839:Sacs	APN	14	61183945	intron	probably benign
IGL02024:Sacs	APN	14	61189678	missense	probably damaging	0.96
IGL02247:Sacs	APN	14	61192535	missense	probably damaging	1.00
F6893:Sacs	UTSW	14	61212976	missense	probably benign
IGL03052:Sacs	UTSW	14	61207858	missense	probably damaging	0.99
R0090:Sacs	UTSW	14	61205440	missense	probably damaging	1.00
R0102:Sacs	UTSW	14	61204568	missense	probably damaging	1.00
R0102:Sacs	UTSW	14	61204568	missense	probably damaging	1.00
R0390:Sacs	UTSW	14	61205640	missense	possibly damaging	0.92
R0479:Sacs	UTSW	14	61191479	missense	probably damaging	0.99
R0556:Sacs	UTSW	14	61183958	missense	probably damaging	0.99
R0673:Sacs	UTSW	14	61210215	missense	possibly damaging	0.89
R0931:Sacs	UTSW	14	61203495	missense	probably benign
R0972:Sacs	UTSW	14	61211963	nonsense	probably null
R1281:Sacs	UTSW	14	61191801	missense	probably benign	0.02
R1340:Sacs	UTSW	14	61204509	missense	probably damaging	0.98
R1351:Sacs	UTSW	14	61202761	missense	probably benign	0.00
R1499:Sacs	UTSW	14	61213704	missense	possibly damaging	0.70
R1538:Sacs	UTSW	14	61210059	missense	probably damaging	0.98
R1581:Sacs	UTSW	14	61213679	missense	probably damaging	0.96
R1599:Sacs	UTSW	14	61203638	missense	probably benign
R1631:Sacs	UTSW	14	61210732	nonsense	probably null
R1635:Sacs	UTSW	14	61203828	missense	probably damaging	0.98
R1655:Sacs	UTSW	14	61191782	missense	probably benign
R1660:Sacs	UTSW	14	61209009	missense	probably damaging	0.99
R1707:Sacs	UTSW	14	61209762	missense	probably benign	0.01
R1733:Sacs	UTSW	14	61205454	missense	probably damaging	1.00
R1772:Sacs	UTSW	14	61210897	missense	probably damaging	1.00
R1976:Sacs	UTSW	14	61202895	missense	probably benign
R2055:Sacs	UTSW	14	61214049	missense	probably damaging	0.97
R2083:Sacs	UTSW	14	61206506	missense	possibly damaging	0.69
R2091:Sacs	UTSW	14	61191919	missense	possibly damaging	0.95
R2105:Sacs	UTSW	14	61173441	missense	possibly damaging	0.90
R2109:Sacs	UTSW	14	61173453	splice site	probably null
R2117:Sacs	UTSW	14	61213771	missense	probably benign	0.01
R2122:Sacs	UTSW	14	61212316	missense	probably damaging	1.00
R2148:Sacs	UTSW	14	61173378	missense	probably damaging	0.97
R2151:Sacs	UTSW	14	61209640	missense	probably damaging	1.00
R2231:Sacs	UTSW	14	61205929	unclassified	probably null
R2248:Sacs	UTSW	14	61212802	missense	probably damaging	1.00
R2271:Sacs	UTSW	14	61204660	missense	probably benign	0.06
R2314:Sacs	UTSW	14	61207759	missense	probably benign	0.17
R2436:Sacs	UTSW	14	61202905	missense	possibly damaging	0.94
R2445:Sacs	UTSW	14	61205206	missense	probably damaging	1.00
R2512:Sacs	UTSW	14	61203080	missense	probably benign	0.00
R3434:Sacs	UTSW	14	61212303	missense	probably damaging	1.00
R3785:Sacs	UTSW	14	61183961	missense	probably damaging	1.00
R3786:Sacs	UTSW	14	61183961	missense	probably damaging	1.00
R3796:Sacs	UTSW	14	61206121	missense	possibly damaging	0.87
R3798:Sacs	UTSW	14	61206121	missense	possibly damaging	0.87
R3872:Sacs	UTSW	14	61148068	missense	probably benign	0.30
R3873:Sacs	UTSW	14	61192286	missense	possibly damaging	0.64
R3892:Sacs	UTSW	14	61204387	missense	probably damaging	0.98
R4184:Sacs	UTSW	14	61213944	missense	probably damaging	0.97
R4204:Sacs	UTSW	14	61173443	missense	possibly damaging	0.93
R4249:Sacs	UTSW	14	61203457	missense	probably benign	0.02
R4256:Sacs	UTSW	14	61206337	missense	probably damaging	1.00
R4370:Sacs	UTSW	14	61212309	missense	probably damaging	1.00
R4445:Sacs	UTSW	14	61204686	missense	probably benign	0.30
R4503:Sacs	UTSW	14	61207603	missense	probably damaging	1.00
R4548:Sacs	UTSW	14	61191938	missense	probably damaging	1.00
R4582:Sacs	UTSW	14	61191698	missense	probably damaging	1.00
R4613:Sacs	UTSW	14	61211797	intron	probably null
R4639:Sacs	UTSW	14	61207268	missense	probably benign	0.12
R4697:Sacs	UTSW	14	61212747	missense	probably benign	0.19
R4706:Sacs	UTSW	14	61204273	missense	probably damaging	1.00
R4717:Sacs	UTSW	14	61212855	missense	probably damaging	1.00
R4777:Sacs	UTSW	14	61211809	missense	probably damaging	1.00
R4888:Sacs	UTSW	14	61212198	missense	probably damaging	1.00
R4913:Sacs	UTSW	14	61213797	missense	probably benign	0.17
R4973:Sacs	UTSW	14	61213122	missense	probably damaging	1.00
R4986:Sacs	UTSW	14	61213043	nonsense	probably null
R5090:Sacs	UTSW	14	61205253	missense	probably damaging	1.00
R5243:Sacs	UTSW	14	61205957	nonsense	probably null
R5292:Sacs	UTSW	14	61211983	missense	probably damaging	1.00
R5308:Sacs	UTSW	14	61192400	missense	probably benign	0.21
R5337:Sacs	UTSW	14	61193514	intron	probably benign
R5502:Sacs	UTSW	14	61206100	missense	probably damaging	1.00
R5586:Sacs	UTSW	14	61206441	nonsense	probably null
R5692:Sacs	UTSW	14	61207839	missense	probably benign	0.00
R5725:Sacs	UTSW	14	61211110	missense	probably damaging	1.00
R5854:Sacs	UTSW	14	61211547	missense	probably damaging	1.00
R5959:Sacs	UTSW	14	61212400	missense	probably damaging	0.99
R5960:Sacs	UTSW	14	61208695	missense	probably benign	0.30
R5968:Sacs	UTSW	14	61189629	missense	probably damaging	0.99
R5983:Sacs	UTSW	14	61205199	missense	probably damaging	1.00
R5992:Sacs	UTSW	14	61205543	missense	probably damaging	1.00
R6076:Sacs	UTSW	14	61204536	nonsense	probably null
R6175:Sacs	UTSW	14	61212826	missense	possibly damaging	0.82
R6347:Sacs	UTSW	14	61211160	missense	probably damaging	1.00
R6357:Sacs	UTSW	14	61208824	missense	possibly damaging	0.47
R6415:Sacs	UTSW	14	61205359	missense	probably damaging	1.00
R6469:Sacs	UTSW	14	61191248	missense	probably damaging	1.00
R6503:Sacs	UTSW	14	61211361	missense	probably benign	0.00
R6523:Sacs	UTSW	14	61202961	missense	probably damaging	0.99
R6615:Sacs	UTSW	14	61208934	missense	probably benign	0.15
R6729:Sacs	UTSW	14	61210518	missense	probably damaging	1.00
R6797:Sacs	UTSW	14	61213073	missense	probably damaging	1.00
R6852:Sacs	UTSW	14	61179288	missense	possibly damaging	0.87
R6922:Sacs	UTSW	14	61211425	missense	probably damaging	1.00
X0067:Sacs	UTSW	14	61208019	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGTAGCAGCCTGCATTACTCAC -3'
(R):5'- AGCCATCAATATTTGGAGCCCGAAC -3'

Sequencing Primer
(F):5'- TGCATTACTCACAATTATAAAAAGCC -3'
(R):5'- GCAAAAGACGCTTCATGTCTTC -3'

Posted On

2013-09-30