Incidental Mutation 'R0738:Plch1'
ID70560
Institutional Source Beutler Lab
Gene Symbol Plch1
Ensembl Gene ENSMUSG00000036834
Gene Namephospholipase C, eta 1
SynonymsPLCeta1, Plcl3
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R0738 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location63696234-63899472 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 63702553 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]
Predicted Effect probably benign
Transcript: ENSMUST00000048134
SMART Domains Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 3 112 2.37e-6 SMART
EFh 128 156 2.41e-4 SMART
EFh 164 193 1.54e-2 SMART
Pfam:EF-hand_like 198 280 2.2e-26 PFAM
PLCXc 281 426 3.13e-71 SMART
low complexity region 440 453 N/A INTRINSIC
low complexity region 564 581 N/A INTRINSIC
PLCYc 583 696 3.4e-49 SMART
C2 715 823 5.47e-22 SMART
low complexity region 979 997 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
low complexity region 1420 1435 N/A INTRINSIC
low complexity region 1543 1557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059973
SMART Domains Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 21 130 1.1e-8 SMART
EFh 146 174 1.1e-6 SMART
EFh 182 211 7.6e-5 SMART
Pfam:EF-hand_like 216 298 4.5e-24 PFAM
PLCXc 299 444 1.6e-73 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 1.7e-51 SMART
C2 733 841 3.7e-24 SMART
low complexity region 1017 1035 N/A INTRINSIC
low complexity region 1117 1129 N/A INTRINSIC
low complexity region 1458 1473 N/A INTRINSIC
low complexity region 1581 1595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084105
SMART Domains Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 2.4e-27 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
low complexity region 1018 1036 N/A INTRINSIC
low complexity region 1118 1130 N/A INTRINSIC
low complexity region 1459 1474 N/A INTRINSIC
low complexity region 1582 1596 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159374
Predicted Effect probably benign
Transcript: ENSMUST00000159676
SMART Domains Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.8e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159982
Predicted Effect probably benign
Transcript: ENSMUST00000160638
SMART Domains Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 5.3e-28 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162269
SMART Domains Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.7e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 583 600 N/A INTRINSIC
PLCYc 602 715 3.4e-49 SMART
C2 734 842 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175947
SMART Domains Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 21 130 2.37e-6 SMART
EFh 146 174 2.41e-4 SMART
EFh 182 211 1.54e-2 SMART
Pfam:EF-hand_like 216 298 1.2e-26 PFAM
PLCXc 299 444 3.13e-71 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
PLCYc 601 714 3.4e-49 SMART
C2 733 841 5.47e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176861
Predicted Effect probably benign
Transcript: ENSMUST00000177143
SMART Domains Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834

DomainStartEndE-ValueType
PH 33 142 2.37e-6 SMART
EFh 158 186 2.41e-4 SMART
EFh 194 223 1.54e-2 SMART
Pfam:EF-hand_like 228 310 2.3e-26 PFAM
PLCXc 311 456 3.13e-71 SMART
low complexity region 470 483 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
PLCYc 613 726 3.4e-49 SMART
C2 745 853 5.47e-22 SMART
low complexity region 1009 1027 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1450 1465 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Mad1l1 A G 5: 140,300,560 L228P probably damaging Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Plch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Plch1 APN 3 63731729 splice site probably null
IGL01542:Plch1 APN 3 63731649 missense probably damaging 0.99
IGL01999:Plch1 APN 3 63753307 missense probably damaging 1.00
IGL02153:Plch1 APN 3 63781351 missense probably damaging 1.00
IGL02203:Plch1 APN 3 63698739 missense possibly damaging 0.46
IGL02220:Plch1 APN 3 63698961 missense probably damaging 0.97
IGL02259:Plch1 APN 3 63722749 critical splice donor site probably null
IGL02268:Plch1 APN 3 63699283 makesense probably null
IGL02411:Plch1 APN 3 63697756 unclassified probably null
IGL02472:Plch1 APN 3 63701849 missense probably damaging 1.00
IGL02477:Plch1 APN 3 63753293 missense probably damaging 1.00
IGL02503:Plch1 APN 3 63697864 missense probably damaging 1.00
IGL02800:Plch1 APN 3 63698478 missense probably benign 0.21
IGL03167:Plch1 APN 3 63722744 splice site probably benign
IGL03182:Plch1 APN 3 63702594 nonsense probably null
IGL03197:Plch1 APN 3 63753170 missense probably damaging 1.00
IGL03251:Plch1 APN 3 63784002 missense possibly damaging 0.93
R0335:Plch1 UTSW 3 63710978 missense probably damaging 1.00
R0347:Plch1 UTSW 3 63753316 missense probably damaging 1.00
R0631:Plch1 UTSW 3 63699219 missense probably benign 0.23
R0687:Plch1 UTSW 3 63716029 missense probably damaging 1.00
R0883:Plch1 UTSW 3 63753256 missense probably damaging 1.00
R1437:Plch1 UTSW 3 63697533 missense probably benign 0.37
R1678:Plch1 UTSW 3 63740694 missense probably damaging 1.00
R1738:Plch1 UTSW 3 63719238 missense probably benign 0.12
R1929:Plch1 UTSW 3 63744535 missense probably damaging 1.00
R1955:Plch1 UTSW 3 63755267 missense probably damaging 0.98
R2078:Plch1 UTSW 3 63701943 missense probably benign 0.01
R2112:Plch1 UTSW 3 63722806 missense probably damaging 1.00
R2158:Plch1 UTSW 3 63721234 missense probably benign 0.00
R2165:Plch1 UTSW 3 63698482 missense probably benign 0.01
R2259:Plch1 UTSW 3 63697977 missense possibly damaging 0.94
R2271:Plch1 UTSW 3 63744535 missense probably damaging 1.00
R3110:Plch1 UTSW 3 63709531 missense probably damaging 1.00
R3112:Plch1 UTSW 3 63709531 missense probably damaging 1.00
R3407:Plch1 UTSW 3 63699347 unclassified probably benign
R3408:Plch1 UTSW 3 63699347 unclassified probably benign
R3791:Plch1 UTSW 3 63699523 missense probably benign
R3793:Plch1 UTSW 3 63697831 missense probably damaging 0.96
R3928:Plch1 UTSW 3 63767623 missense probably damaging 1.00
R4211:Plch1 UTSW 3 63711219 missense probably damaging 1.00
R4212:Plch1 UTSW 3 63870759 start gained probably benign
R4223:Plch1 UTSW 3 63701900 missense probably damaging 1.00
R4491:Plch1 UTSW 3 63740739 missense probably damaging 1.00
R4589:Plch1 UTSW 3 63781507 missense probably damaging 1.00
R4656:Plch1 UTSW 3 63704177 missense probably damaging 1.00
R4701:Plch1 UTSW 3 63699496 intron probably null
R4716:Plch1 UTSW 3 63781546 missense probably damaging 1.00
R4772:Plch1 UTSW 3 63753325 missense probably damaging 1.00
R4902:Plch1 UTSW 3 63740843 intron probably benign
R5058:Plch1 UTSW 3 63722781 missense probably damaging 1.00
R5092:Plch1 UTSW 3 63698710 missense probably benign 0.02
R5093:Plch1 UTSW 3 63773715 missense probably damaging 0.99
R5210:Plch1 UTSW 3 63699778 critical splice donor site probably null
R5368:Plch1 UTSW 3 63701973 missense possibly damaging 0.82
R5373:Plch1 UTSW 3 63698078 missense probably benign 0.01
R5374:Plch1 UTSW 3 63698078 missense probably benign 0.01
R5501:Plch1 UTSW 3 63707741 missense probably damaging 1.00
R5606:Plch1 UTSW 3 63740687 missense probably benign 0.35
R5738:Plch1 UTSW 3 63773655 missense probably damaging 1.00
R5835:Plch1 UTSW 3 63697522 missense probably benign
R6106:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6107:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6108:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6110:Plch1 UTSW 3 63698858 missense possibly damaging 0.62
R6116:Plch1 UTSW 3 63702023 missense probably damaging 1.00
R6147:Plch1 UTSW 3 63722881 missense probably damaging 1.00
R6195:Plch1 UTSW 3 63740789 missense probably damaging 1.00
R6315:Plch1 UTSW 3 63781390 nonsense probably null
R6316:Plch1 UTSW 3 63781390 nonsense probably null
R6317:Plch1 UTSW 3 63781390 nonsense probably null
R6318:Plch1 UTSW 3 63781390 nonsense probably null
R6324:Plch1 UTSW 3 63781390 nonsense probably null
R6325:Plch1 UTSW 3 63781390 nonsense probably null
R6326:Plch1 UTSW 3 63781390 nonsense probably null
R6479:Plch1 UTSW 3 63744510 missense probably benign 0.06
R6544:Plch1 UTSW 3 63850978 missense probably damaging 1.00
R6767:Plch1 UTSW 3 63755344 missense probably damaging 1.00
R6829:Plch1 UTSW 3 63697518 missense probably damaging 0.99
R6891:Plch1 UTSW 3 63698083 missense probably benign
R6893:Plch1 UTSW 3 63753141 nonsense probably null
R6921:Plch1 UTSW 3 63707734 missense possibly damaging 0.90
X0028:Plch1 UTSW 3 63744509 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACAGCTCCATGAAGAATGACTATGCAG -3'
(R):5'- ACTTTCATCAAGGTGGCGGAAAACC -3'

Sequencing Primer
(F):5'- CATCAGCTTTATTATGGGAGGAATGC -3'
(R):5'- GGATGCTCATACCATAAAGTGAC -3'
Posted On2013-09-30