Incidental Mutation 'R0738:Mad1l1'
ID70566
Institutional Source Beutler Lab
Gene Symbol Mad1l1
Ensembl Gene ENSMUSG00000029554
Gene NameMAD1 mitotic arrest deficient 1-like 1
SynonymsMad1
MMRRC Submission 038919-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0738 (G1)
Quality Score93
Status Validated
Chromosome5
Chromosomal Location140008689-140321552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140300560 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 228 (L228P)
Ref Sequence ENSEMBL: ENSMUSP00000106453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031534] [ENSMUST00000110829]
Predicted Effect probably damaging
Transcript: ENSMUST00000031534
AA Change: L228P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031534
Gene: ENSMUSG00000029554
AA Change: L228P

DomainStartEndE-ValueType
Pfam:MAD 54 715 1.6e-272 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110829
AA Change: L228P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106453
Gene: ENSMUSG00000029554
AA Change: L228P

DomainStartEndE-ValueType
Pfam:MAD 2 511 2.5e-198 PFAM
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 92.3%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MAD1L1 is a component of the mitotic spindle-assembly checkpoint that prevents the onset of anaphase until all chromosome are properly aligned at the metaphase plate. MAD1L1 functions as a homodimer and interacts with MAD2L1. MAD1L1 may play a role in cell cycle control and tumor suppression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele die in utero. Aging heterozygous null mice show increased tumor incidence while heterozygous MEFs are more prone to aneuploidy, induce fibrosarcomas in athymic nude mice, and show a weaker spindle assembly checkpoint-mediated arrest n response to nocodazole. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A T 5: 99,240,953 M189K probably benign Het
Ank1 A T 8: 23,114,114 E964D probably damaging Het
Ankhd1 A G 18: 36,645,249 probably benign Het
Cd9 G T 6: 125,462,140 Q169K probably benign Het
Cdc42bpa T A 1: 179,999,462 probably benign Het
Ch25h T C 19: 34,474,387 N247S possibly damaging Het
Dctn1 T C 6: 83,190,107 probably null Het
Defa22 C T 8: 21,162,375 T19I probably benign Het
Dscam T C 16: 96,819,781 N576D possibly damaging Het
Epha3 T C 16: 63,595,612 M675V probably damaging Het
Fam241a C A 3: 127,870,793 A120S possibly damaging Het
Fkbp8 T A 8: 70,529,670 I86N probably damaging Het
Herc4 C T 10: 63,289,149 P514L possibly damaging Het
Ide A T 19: 37,277,965 L813* probably null Het
Igkv12-41 G A 6: 69,858,691 Q26* probably null Het
Itsn2 T C 12: 4,635,681 V483A probably benign Het
Kcp A T 6: 29,490,439 I1002N probably benign Het
Lrfn5 G T 12: 61,840,592 E389* probably null Het
Lrp6 G T 6: 134,542,045 A19E probably benign Het
Map2 T C 1: 66,425,189 probably benign Het
Med13l T A 5: 118,751,633 Y1820N probably damaging Het
Mgam A G 6: 40,754,935 N735S probably benign Het
Mid2 A G X: 140,763,676 Y618C probably damaging Het
Mllt11 G A 3: 95,220,286 Q58* probably null Het
Mttp A G 3: 138,103,313 V678A probably damaging Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Ninj2 A G 6: 120,198,137 probably benign Het
Nsd3 T A 8: 25,678,709 probably null Het
Olfr1454 A T 19: 13,063,738 E109V probably damaging Het
Olfr895 T C 9: 38,269,125 V204A possibly damaging Het
Pcdhb4 A G 18: 37,308,711 N358S probably damaging Het
Plch1 T C 3: 63,702,553 probably benign Het
Popdc3 T C 10: 45,315,258 L155P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm26 A T 14: 105,176,782 I24N unknown Het
Rc3h2 T A 2: 37,405,374 D210V probably damaging Het
Samd1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 8: 83,998,996 probably benign Het
Spopl T C 2: 23,537,521 T200A probably benign Het
Tarbp1 A G 8: 126,438,801 probably null Het
Thnsl1 T A 2: 21,213,362 H121Q probably damaging Het
Tll1 T C 8: 64,101,950 D233G probably damaging Het
Vmn2r27 A T 6: 124,223,702 V432E possibly damaging Het
Wdr5 T C 2: 27,519,412 S49P probably damaging Het
Zfyve26 A T 12: 79,295,534 I46N probably damaging Het
Other mutations in Mad1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Mad1l1 APN 5 140117277 missense probably benign 0.00
IGL02098:Mad1l1 APN 5 140310589 splice site probably benign
IGL02100:Mad1l1 APN 5 140143934 missense probably damaging 1.00
IGL03131:Mad1l1 APN 5 140307703 missense probably benign 0.18
R1902:Mad1l1 UTSW 5 140303688 missense possibly damaging 0.57
R1989:Mad1l1 UTSW 5 140303670 missense probably benign 0.27
R2090:Mad1l1 UTSW 5 140009256 missense probably benign 0.01
R2471:Mad1l1 UTSW 5 140261552 missense probably benign 0.43
R4049:Mad1l1 UTSW 5 140132816 missense probably damaging 1.00
R4050:Mad1l1 UTSW 5 140132816 missense probably damaging 1.00
R4096:Mad1l1 UTSW 5 140307673 missense probably benign 0.01
R4682:Mad1l1 UTSW 5 140300252 missense possibly damaging 0.47
R4729:Mad1l1 UTSW 5 140261511 missense possibly damaging 0.76
R4838:Mad1l1 UTSW 5 140300262 nonsense probably null
R5946:Mad1l1 UTSW 5 140261579 missense probably damaging 1.00
R6088:Mad1l1 UTSW 5 140193963 missense probably benign 0.13
R6362:Mad1l1 UTSW 5 140315055 missense possibly damaging 0.71
R6845:Mad1l1 UTSW 5 140009169 missense probably damaging 1.00
R6957:Mad1l1 UTSW 5 140065817 missense probably damaging 0.99
R6983:Mad1l1 UTSW 5 140193984 missense probably damaging 0.99
R7347:Mad1l1 UTSW 5 140144044 missense probably damaging 1.00
U24488:Mad1l1 UTSW 5 140315085 missense probably damaging 1.00
X0026:Mad1l1 UTSW 5 140009205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTTCCAACTCCAGGTCAACCAG -3'
(R):5'- AGCAGGTTCCCTAGCTTCTGACAC -3'

Sequencing Primer
(F):5'- TCTGTGAGCAGCCCATTG -3'
(R):5'- tagcttcTGACACCTCCATTTTTTTG -3'
Posted On2013-09-30