Incidental Mutation 'R0739:Neo1'
ID70626
Institutional Source Beutler Lab
Gene Symbol Neo1
Ensembl Gene ENSMUSG00000032340
Gene Nameneogenin
Synonyms2610028H22Rik, D930014N22Rik, Igdcc2
MMRRC Submission 038920-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0739 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58874687-59036441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58921877 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 580 (A580T)
Ref Sequence ENSEMBL: ENSMUSP00000063656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068664] [ENSMUST00000214547]
Predicted Effect probably benign
Transcript: ENSMUST00000068664
AA Change: A580T

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000063656
Gene: ENSMUSG00000032340
AA Change: A580T

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
IGc2 76 147 9.49e-5 SMART
IGc2 175 239 4.43e-5 SMART
IGc2 272 338 6.15e-13 SMART
IGc2 364 428 7.76e-10 SMART
low complexity region 446 458 N/A INTRINSIC
FN3 470 553 8.23e-12 SMART
FN3 570 649 1.78e-16 SMART
FN3 665 749 1.54e-11 SMART
FN3 770 849 5.27e-10 SMART
FN3 885 970 7.63e-7 SMART
FN3 986 1072 2.78e-9 SMART
transmembrane domain 1136 1158 N/A INTRINSIC
Pfam:Neogenin_C 1189 1492 1.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214547
AA Change: A580T

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215026
Predicted Effect unknown
Transcript: ENSMUST00000216964
AA Change: A307T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217545
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface protein that is a member of the immunoglobulin superfamily. The encoded protein consists of four N-terminal immunoglobulin-like domains, six fibronectin type III domains, a transmembrane domain and a C-terminal internal domain that shares homology with the tumor suppressor candidate gene DCC. This protein may be involved in cell growth and differentiation and in cell-cell adhesion. Defects in this gene are associated with cell proliferation in certain cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display perinatal lethality and abnormal trigeminal nerve development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,337,135 E327G probably damaging Het
Adcy6 T C 15: 98,598,379 D593G probably benign Het
Ankmy1 T C 1: 92,888,648 D248G probably damaging Het
Atp2a1 T C 7: 126,448,256 I743V possibly damaging Het
Axdnd1 T C 1: 156,380,886 N396D possibly damaging Het
Cacna1e C T 1: 154,442,278 A1391T probably damaging Het
Ccr8 G A 9: 120,094,349 G177S probably damaging Het
Clmn C T 12: 104,781,017 G757D possibly damaging Het
Cntn2 T A 1: 132,529,012 I99F probably damaging Het
D6Ertd527e C G 6: 87,111,668 A271G unknown Het
Dnah1 A T 14: 31,265,915 C3515* probably null Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Elovl4 A G 9: 83,785,109 F65S probably damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbn1 T C 2: 125,367,630 E938G probably benign Het
Foxn1 T C 11: 78,358,999 T567A probably benign Het
Gabrr1 T C 4: 33,162,781 M449T probably benign Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Itgb3bp T C 4: 99,802,196 I29V probably benign Het
Kcnk7 C T 19: 5,704,802 probably null Het
Klf11 T C 12: 24,660,248 S432P probably damaging Het
Nexmif G T X: 104,084,949 Q1121K probably benign Het
Olfr486 T C 7: 108,172,010 T245A probably benign Het
Olfr561 T C 7: 102,774,665 I47T probably damaging Het
Olfr611 T C 7: 103,517,724 Y220C probably damaging Het
Osgepl1 G T 1: 53,323,195 E399* probably null Het
Parvg T A 15: 84,331,021 V197E probably damaging Het
Pcyt2 A G 11: 120,612,044 L257P probably damaging Het
Pou3f2 T C 4: 22,486,960 D391G possibly damaging Het
Psmd2 C T 16: 20,655,329 R261C probably benign Het
Ptpn13 T C 5: 103,575,132 F1981L probably benign Het
Rbp3 A T 14: 33,958,647 I1069F probably benign Het
Rhbdf2 A T 11: 116,600,161 L655Q probably damaging Het
Sec16a A T 2: 26,441,051 N317K possibly damaging Het
Serpina3f T C 12: 104,218,353 V252A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Smyd2 T C 1: 189,888,862 T220A possibly damaging Het
Snrpb2 T A 2: 143,065,361 probably benign Het
Sptan1 A T 2: 30,013,518 I1502F probably damaging Het
Srprb A T 9: 103,197,595 L116H probably damaging Het
Stradb T A 1: 58,977,015 probably benign Het
Tm9sf4 C A 2: 153,203,814 F535L probably damaging Het
Tmprss15 A T 16: 79,024,848 S440T possibly damaging Het
Tpr C T 1: 150,407,497 A293V possibly damaging Het
Usp34 C T 11: 23,467,243 T2964I possibly damaging Het
Usp35 C A 7: 97,311,667 E851* probably null Het
Zc3h14 T A 12: 98,757,201 V250D probably damaging Het
Zfp568 T A 7: 30,023,321 C564S probably damaging Het
Other mutations in Neo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Neo1 APN 9 58921919 splice site probably benign
IGL00885:Neo1 APN 9 58888463 missense probably damaging 1.00
IGL01103:Neo1 APN 9 58880799 missense possibly damaging 0.60
IGL01322:Neo1 APN 9 58907085 missense possibly damaging 0.68
IGL02216:Neo1 APN 9 58917053 missense probably damaging 0.96
IGL02327:Neo1 APN 9 58903088 missense probably benign 0.08
IGL02392:Neo1 APN 9 58925811 missense possibly damaging 0.49
IGL02458:Neo1 APN 9 58893867 splice site probably benign
IGL03057:Neo1 APN 9 58878059 missense probably damaging 1.00
IGL03091:Neo1 APN 9 58978668 missense probably damaging 0.98
IGL03193:Neo1 APN 9 58908484 missense probably damaging 1.00
R0097:Neo1 UTSW 9 58882021 intron probably benign
R0419:Neo1 UTSW 9 58990180 splice site probably benign
R0571:Neo1 UTSW 9 58985786 missense probably benign
R0646:Neo1 UTSW 9 58931034 missense probably damaging 1.00
R0736:Neo1 UTSW 9 58917081 missense possibly damaging 0.78
R1636:Neo1 UTSW 9 58913277 missense probably damaging 1.00
R1694:Neo1 UTSW 9 58880603 missense probably damaging 1.00
R1827:Neo1 UTSW 9 58917031 nonsense probably null
R1927:Neo1 UTSW 9 58990385 missense probably benign 0.12
R2354:Neo1 UTSW 9 58985634 missense probably benign
R2365:Neo1 UTSW 9 58956003 missense probably benign
R3156:Neo1 UTSW 9 58888979 splice site probably null
R3552:Neo1 UTSW 9 58893878 missense probably damaging 1.00
R3829:Neo1 UTSW 9 58913169 missense possibly damaging 0.58
R4477:Neo1 UTSW 9 58877299 missense probably damaging 0.99
R4613:Neo1 UTSW 9 58889041 missense possibly damaging 0.94
R5023:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5046:Neo1 UTSW 9 58893911 missense possibly damaging 0.77
R5057:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5323:Neo1 UTSW 9 58906648 critical splice donor site probably null
R5394:Neo1 UTSW 9 58990234 missense probably benign 0.10
R5470:Neo1 UTSW 9 58931067 missense probably damaging 1.00
R5473:Neo1 UTSW 9 58880843 missense possibly damaging 0.88
R5500:Neo1 UTSW 9 58917054 missense possibly damaging 0.94
R5503:Neo1 UTSW 9 58985650 missense possibly damaging 0.67
R6122:Neo1 UTSW 9 58917008 missense probably benign
R6191:Neo1 UTSW 9 58889029 missense probably damaging 1.00
R6431:Neo1 UTSW 9 58907071 missense probably benign 0.27
R6560:Neo1 UTSW 9 58880601 missense possibly damaging 0.95
R6658:Neo1 UTSW 9 58921849 missense probably benign 0.14
R6772:Neo1 UTSW 9 58902976 missense probably damaging 1.00
R6912:Neo1 UTSW 9 58917052 missense probably benign 0.00
R7061:Neo1 UTSW 9 58990441 missense possibly damaging 0.95
R7145:Neo1 UTSW 9 58889179 missense probably damaging 1.00
R7156:Neo1 UTSW 9 58902923 missense probably damaging 1.00
X0063:Neo1 UTSW 9 58990298 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGCACATCTTGTACGCTAGGTAATGTTC -3'
(R):5'- GTTCAACAGCAGAAAGGTCTCTTCCA -3'

Sequencing Primer
(F):5'- ACGCTAGGTAATGTTCTACTGC -3'
(R):5'- tggggaagggagcaggg -3'
Posted On2013-09-30