Incidental Mutation 'R0739:Elovl4'
ID70627
Institutional Source Beutler Lab
Gene Symbol Elovl4
Ensembl Gene ENSMUSG00000032262
Gene Nameelongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4
Synonyms
MMRRC Submission 038920-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0739 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location83778692-83806277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83785109 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 65 (F65S)
Ref Sequence ENSEMBL: ENSMUSP00000139163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034796] [ENSMUST00000183614]
Predicted Effect probably damaging
Transcript: ENSMUST00000034796
AA Change: F156S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034796
Gene: ENSMUSG00000032262
AA Change: F156S

DomainStartEndE-ValueType
Pfam:ELO 41 278 1e-69 PFAM
low complexity region 300 311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183614
AA Change: F65S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139163
Gene: ENSMUSG00000032262
AA Change: F65S

DomainStartEndE-ValueType
Pfam:ELO 9 181 1.6e-50 PFAM
Meta Mutation Damage Score 0.408 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein which is a member of the ELO family, proteins which participate in the biosynthesis of fatty acids. Consistent with the expression of the encoded protein in photoreceptor cells of the retina, mutations and small deletions in this gene are associated with Stargardt-like macular dystrophy (STGD3) and autosomal dominant Stargardt-like macular dystrophy (ADMD), also referred to as autosomal dominant atrophic macular degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before or around birth. Mice heterozygous for a null allele breed poorly and display mild retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,337,135 E327G probably damaging Het
Adcy6 T C 15: 98,598,379 D593G probably benign Het
Ankmy1 T C 1: 92,888,648 D248G probably damaging Het
Atp2a1 T C 7: 126,448,256 I743V possibly damaging Het
Axdnd1 T C 1: 156,380,886 N396D possibly damaging Het
Cacna1e C T 1: 154,442,278 A1391T probably damaging Het
Ccr8 G A 9: 120,094,349 G177S probably damaging Het
Clmn C T 12: 104,781,017 G757D possibly damaging Het
Cntn2 T A 1: 132,529,012 I99F probably damaging Het
D6Ertd527e C G 6: 87,111,668 A271G unknown Het
Dnah1 A T 14: 31,265,915 C3515* probably null Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fbn1 T C 2: 125,367,630 E938G probably benign Het
Foxn1 T C 11: 78,358,999 T567A probably benign Het
Gabrr1 T C 4: 33,162,781 M449T probably benign Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Itgb3bp T C 4: 99,802,196 I29V probably benign Het
Kcnk7 C T 19: 5,704,802 probably null Het
Klf11 T C 12: 24,660,248 S432P probably damaging Het
Neo1 C T 9: 58,921,877 A580T probably benign Het
Nexmif G T X: 104,084,949 Q1121K probably benign Het
Olfr486 T C 7: 108,172,010 T245A probably benign Het
Olfr561 T C 7: 102,774,665 I47T probably damaging Het
Olfr611 T C 7: 103,517,724 Y220C probably damaging Het
Osgepl1 G T 1: 53,323,195 E399* probably null Het
Parvg T A 15: 84,331,021 V197E probably damaging Het
Pcyt2 A G 11: 120,612,044 L257P probably damaging Het
Pou3f2 T C 4: 22,486,960 D391G possibly damaging Het
Psmd2 C T 16: 20,655,329 R261C probably benign Het
Ptpn13 T C 5: 103,575,132 F1981L probably benign Het
Rbp3 A T 14: 33,958,647 I1069F probably benign Het
Rhbdf2 A T 11: 116,600,161 L655Q probably damaging Het
Sec16a A T 2: 26,441,051 N317K possibly damaging Het
Serpina3f T C 12: 104,218,353 V252A probably damaging Het
Slc22a23 C T 13: 34,344,383 G139S possibly damaging Het
Smyd2 T C 1: 189,888,862 T220A possibly damaging Het
Snrpb2 T A 2: 143,065,361 probably benign Het
Sptan1 A T 2: 30,013,518 I1502F probably damaging Het
Srprb A T 9: 103,197,595 L116H probably damaging Het
Stradb T A 1: 58,977,015 probably benign Het
Tm9sf4 C A 2: 153,203,814 F535L probably damaging Het
Tmprss15 A T 16: 79,024,848 S440T possibly damaging Het
Tpr C T 1: 150,407,497 A293V possibly damaging Het
Usp34 C T 11: 23,467,243 T2964I possibly damaging Het
Usp35 C A 7: 97,311,667 E851* probably null Het
Zc3h14 T A 12: 98,757,201 V250D probably damaging Het
Zfp568 T A 7: 30,023,321 C564S probably damaging Het
Other mutations in Elovl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
hershey UTSW 9 83806038 start codon destroyed probably null 0.31
R0278:Elovl4 UTSW 9 83783195 missense probably benign 0.00
R0563:Elovl4 UTSW 9 83785034 critical splice donor site probably null
R0771:Elovl4 UTSW 9 83785115 missense possibly damaging 0.95
R1970:Elovl4 UTSW 9 83780719 missense probably damaging 1.00
R2316:Elovl4 UTSW 9 83780773 missense probably damaging 1.00
R3777:Elovl4 UTSW 9 83785148 frame shift probably null
R3779:Elovl4 UTSW 9 83785148 frame shift probably null
R4823:Elovl4 UTSW 9 83780685 missense probably damaging 1.00
R4827:Elovl4 UTSW 9 83806038 start codon destroyed probably null 0.31
R5264:Elovl4 UTSW 9 83780764 missense probably benign 0.19
R5275:Elovl4 UTSW 9 83780661 missense possibly damaging 0.72
R5295:Elovl4 UTSW 9 83780661 missense possibly damaging 0.72
R5361:Elovl4 UTSW 9 83790101 missense possibly damaging 0.95
R5364:Elovl4 UTSW 9 83790023 missense probably benign 0.21
R5897:Elovl4 UTSW 9 83790104 missense possibly damaging 0.50
R6433:Elovl4 UTSW 9 83785178 missense possibly damaging 0.46
R6668:Elovl4 UTSW 9 83805986 missense probably benign 0.02
R6844:Elovl4 UTSW 9 83790111 missense probably benign 0.09
R6897:Elovl4 UTSW 9 83783225 missense probably benign 0.05
R6933:Elovl4 UTSW 9 83785100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATACCGCCCTTAGTCTACAGCC -3'
(R):5'- CCTACCTCTCGGAAGAACGATTGC -3'

Sequencing Primer
(F):5'- GCGTTCTATCAGATCAGAACTGC -3'
(R):5'- GAAGAACGATTGCGTACCTTG -3'
Posted On2013-09-30