Mutagenetix > Incidental Mutation

Incidental Mutation 'R0741:Kif21b'

70672

Institutional Source

Beutler Lab

Gene Symbol

Kif21b

Ensembl Gene

ENSMUSG00000041642

Gene Name

kinesin family member 21B

Synonyms

2610511N21Rik, N-5 kinesin

MMRRC Submission

038922-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

R0741 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

136059127-136105736 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 136087482 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 933 (T933A)

Ref Sequence

ENSEMBL: ENSMUSP00000114297 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864] [ENSMUST00000171381]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000075164
AA Change: T933A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: T933A

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127624

Predicted Effect

probably damaging
Transcript: ENSMUST00000130864
AA Change: T933A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: T933A

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	5.1e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171381

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano7	T	A	1: 93,329,309 (GRCm39)	I701N	probably damaging	Het
Asb7	A	T	7: 66,309,882 (GRCm39)	N111K	probably benign	Het
Atp10a	T	A	7: 58,478,337 (GRCm39)	L1460Q	possibly damaging	Het
Auh	T	C	13: 53,083,638 (GRCm39)	T14A	possibly damaging	Het
Caskin2	A	G	11: 115,695,626 (GRCm39)	V245A	probably damaging	Het
Cryba4	G	A	5: 112,394,554 (GRCm39)	R192C	probably damaging	Het
Ctsq	T	A	13: 61,184,019 (GRCm39)	D301V	probably damaging	Het
Dpyd	A	G	3: 118,468,154 (GRCm39)	E56G	possibly damaging	Het
Dtd2	T	C	12: 52,046,455 (GRCm39)	K128R	probably benign	Het
Eps8l3	A	G	3: 107,790,141 (GRCm39)	T141A	probably benign	Het
Evc	A	T	5: 37,483,739 (GRCm39)	I187N	possibly damaging	Het
Fam120a	A	G	13: 49,045,416 (GRCm39)	S807P	possibly damaging	Het
Fbxw22	G	A	9: 109,211,287 (GRCm39)	S338L	probably benign	Het
Gcnt4	G	T	13: 97,082,940 (GRCm39)	E79*	probably null	Het
Get4	G	A	5: 139,249,384 (GRCm39)		probably benign	Het
Hipk1	A	G	3: 103,654,128 (GRCm39)	V954A	probably benign	Het
Ifi206	C	T	1: 173,301,315 (GRCm39)	V788M	probably benign	Het
Iqgap1	A	G	7: 80,370,735 (GRCm39)	S1545P	probably benign	Het
Lgr6	C	T	1: 134,921,748 (GRCm39)	A199T	probably damaging	Het
Magee2	A	G	X: 103,899,472 (GRCm39)	L393P	probably damaging	Het
Mtrr	T	C	13: 68,727,658 (GRCm39)		probably null	Het
Nes	A	G	3: 87,886,274 (GRCm39)	E1467G	probably damaging	Het
Nol3	C	G	8: 106,005,756 (GRCm39)	A50G	probably damaging	Het
Nr2f2	G	A	7: 70,007,745 (GRCm39)	R113C	probably damaging	Het
Obscn	CCACACACACACAC	CCACACACACAC	11: 58,954,279 (GRCm39)		probably null	Het
Or10a3m	T	A	7: 108,312,811 (GRCm39)	C84S	probably benign	Het
Pnkd	T	A	1: 74,391,018 (GRCm39)	S337R	possibly damaging	Het
Ptprh	A	G	7: 4,557,172 (GRCm39)		probably null	Het
Ralgapa1	A	C	12: 55,723,366 (GRCm39)	V1767G	probably damaging	Het
Sema6a	G	A	18: 47,423,112 (GRCm39)		probably null	Het
Skap1	A	C	11: 96,383,759 (GRCm39)		probably benign	Het
Trip12	A	G	1: 84,722,902 (GRCm39)	S1250P	probably benign	Het
Txndc5	T	C	13: 38,712,236 (GRCm39)	H50R	possibly damaging	Het
Usp25	C	A	16: 76,868,596 (GRCm39)	D332E	possibly damaging	Het
Vgll1	A	T	X: 56,141,644 (GRCm39)		probably benign	Het

Other mutations in Kif21b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Kif21b	APN	1	136,080,080 (GRCm39)	missense	possibly damaging	0.68
IGL01020:Kif21b	APN	1	136,081,832 (GRCm39)	splice site	probably benign
IGL01288:Kif21b	APN	1	136,099,922 (GRCm39)	missense	probably benign	0.00
IGL02105:Kif21b	APN	1	136,099,041 (GRCm39)	missense	probably benign
IGL02264:Kif21b	APN	1	136,087,495 (GRCm39)	missense	probably damaging	1.00
IGL02303:Kif21b	APN	1	136,087,495 (GRCm39)	missense	probably damaging	1.00
IGL02308:Kif21b	APN	1	136,087,495 (GRCm39)	missense	probably damaging	1.00
IGL02310:Kif21b	APN	1	136,087,495 (GRCm39)	missense	probably damaging	1.00
IGL02419:Kif21b	APN	1	136,079,005 (GRCm39)	missense	probably benign	0.00
IGL02553:Kif21b	APN	1	136,081,859 (GRCm39)	missense	probably damaging	1.00
IGL02568:Kif21b	APN	1	136,100,605 (GRCm39)	missense	probably damaging	0.96
IGL02657:Kif21b	APN	1	136,099,968 (GRCm39)	missense	possibly damaging	0.88
IGL03068:Kif21b	APN	1	136,086,093 (GRCm39)	unclassified	probably benign
IGL03230:Kif21b	APN	1	136,090,550 (GRCm39)	missense	probably benign	0.03
R0629_Kif21b_729	UTSW	1	136,099,895 (GRCm39)	critical splice acceptor site	probably null
Schiessen	UTSW	1	136,075,607 (GRCm39)	critical splice donor site	probably null
wolfen	UTSW	1	136,072,496 (GRCm39)	nonsense	probably null
R0190:Kif21b	UTSW	1	136,098,957 (GRCm39)	missense	probably benign	0.32
R0349:Kif21b	UTSW	1	136,077,049 (GRCm39)	missense	probably damaging	0.97
R0501:Kif21b	UTSW	1	136,090,837 (GRCm39)	missense	probably benign	0.44
R0620:Kif21b	UTSW	1	136,087,166 (GRCm39)	missense	possibly damaging	0.88
R0629:Kif21b	UTSW	1	136,099,895 (GRCm39)	critical splice acceptor site	probably null
R1087:Kif21b	UTSW	1	136,090,561 (GRCm39)	missense	probably damaging	1.00
R1217:Kif21b	UTSW	1	136,080,114 (GRCm39)	missense	probably damaging	1.00
R1464:Kif21b	UTSW	1	136,083,891 (GRCm39)	missense	possibly damaging	0.50
R1464:Kif21b	UTSW	1	136,083,891 (GRCm39)	missense	possibly damaging	0.50
R1511:Kif21b	UTSW	1	136,097,062 (GRCm39)	critical splice donor site	probably null
R1512:Kif21b	UTSW	1	136,080,543 (GRCm39)	missense	probably benign	0.01
R1513:Kif21b	UTSW	1	136,083,849 (GRCm39)	missense	probably damaging	0.98
R1591:Kif21b	UTSW	1	136,077,055 (GRCm39)	missense	probably damaging	1.00
R1616:Kif21b	UTSW	1	136,099,423 (GRCm39)	missense	probably damaging	1.00
R1628:Kif21b	UTSW	1	136,098,958 (GRCm39)	missense	probably benign	0.01
R1658:Kif21b	UTSW	1	136,099,023 (GRCm39)	missense	probably damaging	1.00
R1728:Kif21b	UTSW	1	136,087,859 (GRCm39)	missense	possibly damaging	0.85
R1741:Kif21b	UTSW	1	136,083,880 (GRCm39)	missense	probably damaging	1.00
R1784:Kif21b	UTSW	1	136,087,859 (GRCm39)	missense	possibly damaging	0.85
R1807:Kif21b	UTSW	1	136,075,531 (GRCm39)	missense	possibly damaging	0.94
R1896:Kif21b	UTSW	1	136,075,583 (GRCm39)	missense	possibly damaging	0.90
R1970:Kif21b	UTSW	1	136,098,894 (GRCm39)	missense	probably damaging	1.00
R1984:Kif21b	UTSW	1	136,075,284 (GRCm39)	missense	probably damaging	1.00
R1985:Kif21b	UTSW	1	136,075,284 (GRCm39)	missense	probably damaging	1.00
R1986:Kif21b	UTSW	1	136,075,284 (GRCm39)	missense	probably damaging	1.00
R1988:Kif21b	UTSW	1	136,080,002 (GRCm39)	missense	probably damaging	0.98
R1990:Kif21b	UTSW	1	136,089,508 (GRCm39)	missense	probably damaging	1.00
R2014:Kif21b	UTSW	1	136,076,020 (GRCm39)	missense	probably damaging	1.00
R2045:Kif21b	UTSW	1	136,088,051 (GRCm39)	missense	probably damaging	1.00
R2141:Kif21b	UTSW	1	136,080,002 (GRCm39)	missense	probably damaging	0.98
R2248:Kif21b	UTSW	1	136,100,704 (GRCm39)	missense	probably damaging	1.00
R2886:Kif21b	UTSW	1	136,075,612 (GRCm39)	splice site	probably benign
R2896:Kif21b	UTSW	1	136,081,955 (GRCm39)	missense	possibly damaging	0.82
R3706:Kif21b	UTSW	1	136,087,148 (GRCm39)	missense	probably benign	0.06
R3780:Kif21b	UTSW	1	136,083,964 (GRCm39)	missense	probably damaging	0.99
R3827:Kif21b	UTSW	1	136,090,732 (GRCm39)	critical splice donor site	probably null
R4227:Kif21b	UTSW	1	136,081,831 (GRCm39)	splice site	probably null
R4600:Kif21b	UTSW	1	136,075,602 (GRCm39)	missense	probably benign	0.39
R4608:Kif21b	UTSW	1	136,075,924 (GRCm39)	intron	probably benign
R4749:Kif21b	UTSW	1	136,072,487 (GRCm39)	nonsense	probably null
R4841:Kif21b	UTSW	1	136,072,958 (GRCm39)	missense	probably damaging	1.00
R4842:Kif21b	UTSW	1	136,072,958 (GRCm39)	missense	probably damaging	1.00
R4933:Kif21b	UTSW	1	136,079,063 (GRCm39)	splice site	probably null
R4959:Kif21b	UTSW	1	136,076,108 (GRCm39)	missense	possibly damaging	0.90
R5018:Kif21b	UTSW	1	136,099,972 (GRCm39)	missense	probably benign	0.30
R5116:Kif21b	UTSW	1	136,080,521 (GRCm39)	missense	probably damaging	0.99
R5119:Kif21b	UTSW	1	136,090,838 (GRCm39)	missense	probably benign
R5197:Kif21b	UTSW	1	136,072,363 (GRCm39)	missense	probably damaging	1.00
R5230:Kif21b	UTSW	1	136,099,411 (GRCm39)	missense	probably damaging	1.00
R5249:Kif21b	UTSW	1	136,096,966 (GRCm39)	missense	probably damaging	1.00
R5337:Kif21b	UTSW	1	136,098,881 (GRCm39)	missense	probably damaging	1.00
R5358:Kif21b	UTSW	1	136,100,030 (GRCm39)	missense	possibly damaging	0.85
R5466:Kif21b	UTSW	1	136,075,263 (GRCm39)	missense	probably damaging	1.00
R5557:Kif21b	UTSW	1	136,097,797 (GRCm39)	missense	probably damaging	1.00
R5727:Kif21b	UTSW	1	136,097,747 (GRCm39)	missense	probably damaging	1.00
R5865:Kif21b	UTSW	1	136,078,875 (GRCm39)	nonsense	probably null
R5929:Kif21b	UTSW	1	136,078,945 (GRCm39)	missense	probably damaging	1.00
R6274:Kif21b	UTSW	1	136,077,156 (GRCm39)	missense	possibly damaging	0.57
R6349:Kif21b	UTSW	1	136,086,064 (GRCm39)	missense	probably damaging	1.00
R6648:Kif21b	UTSW	1	136,080,135 (GRCm39)	missense	probably benign	0.00
R6831:Kif21b	UTSW	1	136,072,496 (GRCm39)	nonsense	probably null
R7156:Kif21b	UTSW	1	136,075,562 (GRCm39)	missense	probably damaging	1.00
R7165:Kif21b	UTSW	1	136,077,186 (GRCm39)	missense	probably damaging	0.98
R7327:Kif21b	UTSW	1	136,087,387 (GRCm39)	missense	possibly damaging	0.60
R7680:Kif21b	UTSW	1	136,075,607 (GRCm39)	critical splice donor site	probably null
R7975:Kif21b	UTSW	1	136,098,911 (GRCm39)	missense	probably damaging	1.00
R8356:Kif21b	UTSW	1	136,100,683 (GRCm39)	missense	probably damaging	1.00
R8467:Kif21b	UTSW	1	136,100,021 (GRCm39)	missense	probably damaging	0.98
R9031:Kif21b	UTSW	1	136,073,042 (GRCm39)	missense	probably damaging	0.99
R9101:Kif21b	UTSW	1	136,078,893 (GRCm39)	missense	probably damaging	0.96
R9191:Kif21b	UTSW	1	136,100,559 (GRCm39)	nonsense	probably null
R9261:Kif21b	UTSW	1	136,077,162 (GRCm39)	missense	probably damaging	1.00
R9280:Kif21b	UTSW	1	136,099,445 (GRCm39)	critical splice donor site	probably null
R9307:Kif21b	UTSW	1	136,101,800 (GRCm39)	missense	probably benign
R9562:Kif21b	UTSW	1	136,077,090 (GRCm39)	missense	probably damaging	0.99
R9563:Kif21b	UTSW	1	136,077,166 (GRCm39)	missense	probably damaging	1.00
R9565:Kif21b	UTSW	1	136,077,090 (GRCm39)	missense	probably damaging	0.99
R9758:Kif21b	UTSW	1	136,080,961 (GRCm39)	missense	probably damaging	1.00
R9760:Kif21b	UTSW	1	136,076,421 (GRCm39)	missense	probably damaging	1.00
RF024:Kif21b	UTSW	1	136,086,079 (GRCm39)	missense	probably damaging	1.00
X0053:Kif21b	UTSW	1	136,077,054 (GRCm39)	missense	probably damaging	1.00
X0066:Kif21b	UTSW	1	136,100,683 (GRCm39)	missense	probably damaging	1.00
Z1176:Kif21b	UTSW	1	136,081,875 (GRCm39)	missense	probably benign	0.00
Z1177:Kif21b	UTSW	1	136,076,050 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCATAGTGCGTCAGTGGAACC -3'
(R):5'- TGGCTGCCAACACTTCGATCTC -3'

Sequencing Primer
(F):5'- GGAAGATCGACCACTTCCTG -3'
(R):5'- TACAGCTCAGGCACAGGC -3'

Posted On

2013-09-30