Incidental Mutation 'R0741:Nes'
ID70674
Institutional Source Beutler Lab
Gene Symbol Nes
Ensembl Gene ENSMUSG00000004891
Gene Namenestin
SynonymsESTM46
MMRRC Submission 038922-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.625) question?
Stock #R0741 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87971078-87980451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87978967 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1467 (E1467G)
Ref Sequence ENSEMBL: ENSMUSP00000125571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090973] [ENSMUST00000160694]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090973
AA Change: E1511G

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088493
Gene: ENSMUSG00000004891
AA Change: E1511G

DomainStartEndE-ValueType
Filament 7 313 1.81e-37 SMART
low complexity region 439 448 N/A INTRINSIC
internal_repeat_2 470 771 2.37e-7 PROSPERO
internal_repeat_1 614 832 5.41e-11 PROSPERO
internal_repeat_2 851 1174 2.37e-7 PROSPERO
internal_repeat_1 1064 1304 5.41e-11 PROSPERO
low complexity region 1347 1366 N/A INTRINSIC
low complexity region 1426 1438 N/A INTRINSIC
low complexity region 1653 1683 N/A INTRINSIC
low complexity region 1713 1724 N/A INTRINSIC
low complexity region 1741 1760 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160694
AA Change: E1467G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125571
Gene: ENSMUSG00000004891
AA Change: E1467G

DomainStartEndE-ValueType
Pfam:Filament 7 313 3.5e-29 PFAM
low complexity region 439 448 N/A INTRINSIC
internal_repeat_2 456 672 1.06e-5 PROSPERO
internal_repeat_1 470 798 1.21e-11 PROSPERO
internal_repeat_1 807 1134 1.21e-11 PROSPERO
internal_repeat_2 1024 1213 1.06e-5 PROSPERO
low complexity region 1303 1322 N/A INTRINSIC
low complexity region 1382 1394 N/A INTRINSIC
low complexity region 1609 1639 N/A INTRINSIC
low complexity region 1669 1680 N/A INTRINSIC
low complexity region 1697 1716 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display a high incidence of embryonic lethality, reduced embryo and birth body size, and fewer neural stem cells and increased apoptosis in the neuroepithelium of the developing neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 T A 1: 93,401,587 I701N probably damaging Het
Asb7 A T 7: 66,660,134 N111K probably benign Het
Atp10a T A 7: 58,828,589 L1460Q possibly damaging Het
Auh T C 13: 52,929,602 T14A possibly damaging Het
Caskin2 A G 11: 115,804,800 V245A probably damaging Het
Cryba4 G A 5: 112,246,688 R192C probably damaging Het
Ctsq T A 13: 61,036,205 D301V probably damaging Het
Dpyd A G 3: 118,674,505 E56G possibly damaging Het
Dtd2 T C 12: 51,999,672 K128R probably benign Het
Eps8l3 A G 3: 107,882,825 T141A probably benign Het
Evc A T 5: 37,326,395 I187N possibly damaging Het
Fam120a A G 13: 48,891,940 S807P possibly damaging Het
Fbxw22 G A 9: 109,382,219 S338L probably benign Het
Gcnt4 G T 13: 96,946,432 E79* probably null Het
Get4 G A 5: 139,263,629 probably benign Het
Hipk1 A G 3: 103,746,812 V954A probably benign Het
Ifi206 C T 1: 173,473,749 V788M probably benign Het
Iqgap1 A G 7: 80,720,987 S1545P probably benign Het
Kif21b A G 1: 136,159,744 T933A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Magee2 A G X: 104,855,866 L393P probably damaging Het
Mtrr T C 13: 68,579,539 probably null Het
Nol3 C G 8: 105,279,124 A50G probably damaging Het
Nr2f2 G A 7: 70,357,997 R113C probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 59,063,453 probably null Het
Olfr512 T A 7: 108,713,604 C84S probably benign Het
Pnkd T A 1: 74,351,859 S337R possibly damaging Het
Ptprh A G 7: 4,554,173 probably null Het
Ralgapa1 A C 12: 55,676,581 V1767G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skap1 A C 11: 96,492,933 probably benign Het
Trip12 A G 1: 84,745,181 S1250P probably benign Het
Txndc5 T C 13: 38,528,260 H50R possibly damaging Het
Usp25 C A 16: 77,071,708 D332E possibly damaging Het
Vgll1 A T X: 57,096,284 probably benign Het
Other mutations in Nes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Nes APN 3 87976254 nonsense probably null
IGL01532:Nes APN 3 87978347 missense possibly damaging 0.54
IGL01544:Nes APN 3 87977964 missense possibly damaging 0.93
IGL02609:Nes APN 3 87977221 missense probably benign 0.33
IGL02877:Nes APN 3 87975661 missense probably benign 0.04
IGL02937:Nes APN 3 87979879 missense probably benign
R0271:Nes UTSW 3 87978642 missense possibly damaging 0.91
R0587:Nes UTSW 3 87978569 missense probably benign 0.08
R0625:Nes UTSW 3 87977172 missense possibly damaging 0.91
R1256:Nes UTSW 3 87976576 missense probably benign
R1630:Nes UTSW 3 87977677 missense probably benign 0.32
R1702:Nes UTSW 3 87975979 missense probably benign 0.04
R1724:Nes UTSW 3 87977441 missense probably benign
R1738:Nes UTSW 3 87976421 nonsense probably null
R1853:Nes UTSW 3 87975807 missense possibly damaging 0.91
R1946:Nes UTSW 3 87978514 missense possibly damaging 0.79
R1971:Nes UTSW 3 87978327 missense possibly damaging 0.81
R2013:Nes UTSW 3 87976678 missense possibly damaging 0.51
R2111:Nes UTSW 3 87977311 missense probably benign 0.04
R2232:Nes UTSW 3 87978931 missense possibly damaging 0.93
R2392:Nes UTSW 3 87975943 missense probably benign 0.08
R3548:Nes UTSW 3 87973122 splice site probably benign
R3937:Nes UTSW 3 87971236 missense probably benign 0.02
R4239:Nes UTSW 3 87979359 missense probably damaging 1.00
R4240:Nes UTSW 3 87979359 missense probably damaging 1.00
R4426:Nes UTSW 3 87976042 missense probably damaging 0.96
R4493:Nes UTSW 3 87976813 missense probably damaging 0.96
R4494:Nes UTSW 3 87976813 missense probably damaging 0.96
R4674:Nes UTSW 3 87971795 missense possibly damaging 0.51
R4772:Nes UTSW 3 87976179 missense probably benign 0.02
R4959:Nes UTSW 3 87975676 missense probably damaging 0.99
R4973:Nes UTSW 3 87975676 missense probably damaging 0.99
R5055:Nes UTSW 3 87977214 missense probably benign
R5207:Nes UTSW 3 87978628 missense probably damaging 1.00
R5289:Nes UTSW 3 87978418 missense probably damaging 0.98
R5420:Nes UTSW 3 87977002 missense probably damaging 0.99
R5424:Nes UTSW 3 87978824 missense possibly damaging 0.94
R5697:Nes UTSW 3 87977848 missense probably damaging 0.96
R5940:Nes UTSW 3 87975952 missense probably damaging 0.99
R6661:Nes UTSW 3 87976936 missense probably damaging 0.96
R6905:Nes UTSW 3 87978678 missense probably damaging 0.99
R7087:Nes UTSW 3 87979758 missense not run
X0019:Nes UTSW 3 87977418 missense probably benign 0.15
X0062:Nes UTSW 3 87977726 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCAAGACTAGCAGTGAGACTCTG -3'
(R):5'- CTTGAGGGAAAAGCCTCTGTTCTCC -3'

Sequencing Primer
(F):5'- CTAGCAGTGAGACTCTGGAATGC -3'
(R):5'- AAAGCCTCTGTTCTCCAGCTTG -3'
Posted On2013-09-30