Incidental Mutation 'R0741:Dpyd'
ID70677
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Namedihydropyrimidine dehydrogenase
SynonymsDPD, E330028L06Rik
MMRRC Submission 038922-MU
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R0741 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location118562129-119432924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118674505 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 56 (E56G)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177] [ENSMUST00000149101]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039177
AA Change: E56G

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: E56G

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126254
Predicted Effect possibly damaging
Transcript: ENSMUST00000149101
AA Change: E56G

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143022
Gene: ENSMUSG00000033308
AA Change: E56G

DomainStartEndE-ValueType
PDB:1H7X|D 1 78 2e-40 PDB
SCOP:d1gtea1 2 78 3e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150950
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 T A 1: 93,401,587 I701N probably damaging Het
Asb7 A T 7: 66,660,134 N111K probably benign Het
Atp10a T A 7: 58,828,589 L1460Q possibly damaging Het
Auh T C 13: 52,929,602 T14A possibly damaging Het
Caskin2 A G 11: 115,804,800 V245A probably damaging Het
Cryba4 G A 5: 112,246,688 R192C probably damaging Het
Ctsq T A 13: 61,036,205 D301V probably damaging Het
Dtd2 T C 12: 51,999,672 K128R probably benign Het
Eps8l3 A G 3: 107,882,825 T141A probably benign Het
Evc A T 5: 37,326,395 I187N possibly damaging Het
Fam120a A G 13: 48,891,940 S807P possibly damaging Het
Fbxw22 G A 9: 109,382,219 S338L probably benign Het
Gcnt4 G T 13: 96,946,432 E79* probably null Het
Get4 G A 5: 139,263,629 probably benign Het
Hipk1 A G 3: 103,746,812 V954A probably benign Het
Ifi206 C T 1: 173,473,749 V788M probably benign Het
Iqgap1 A G 7: 80,720,987 S1545P probably benign Het
Kif21b A G 1: 136,159,744 T933A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Magee2 A G X: 104,855,866 L393P probably damaging Het
Mtrr T C 13: 68,579,539 probably null Het
Nes A G 3: 87,978,967 E1467G probably damaging Het
Nol3 C G 8: 105,279,124 A50G probably damaging Het
Nr2f2 G A 7: 70,357,997 R113C probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 59,063,453 probably null Het
Olfr512 T A 7: 108,713,604 C84S probably benign Het
Pnkd T A 1: 74,351,859 S337R possibly damaging Het
Ptprh A G 7: 4,554,173 probably null Het
Ralgapa1 A C 12: 55,676,581 V1767G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skap1 A C 11: 96,492,933 probably benign Het
Trip12 A G 1: 84,745,181 S1250P probably benign Het
Txndc5 T C 13: 38,528,260 H50R possibly damaging Het
Usp25 C A 16: 77,071,708 D332E possibly damaging Het
Vgll1 A T X: 57,096,284 probably benign Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATCATAGGACTGGAGAGTTTGTGGC -3'
(R):5'- GCACTGAGGCTTAACATTTATGCAGC -3'

Sequencing Primer
(F):5'- GGCTGTTGAATTTCACTGTCG -3'
(R):5'- ATACCTTAGAGAACAGAGCTGAATGC -3'
Posted On2013-09-30