Incidental Mutation 'R0742:Aff3'
ID70709
Institutional Source Beutler Lab
Gene Symbol Aff3
Ensembl Gene ENSMUSG00000037138
Gene NameAF4/FMR2 family, member 3
SynonymsLaf4, LAF-4, 3222402O04Rik
MMRRC Submission 038923-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0742 (G1)
Quality Score201
Status Not validated
Chromosome1
Chromosomal Location38177326-38664955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38627108 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 12 (W12R)
Ref Sequence ENSEMBL: ENSMUSP00000092637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039827] [ENSMUST00000095027] [ENSMUST00000134963] [ENSMUST00000212668]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000027250
SMART Domains Protein: ENSMUSP00000027250
Gene: ENSMUSG00000037138

DomainStartEndE-ValueType
Pfam:AF-4 20 171 2.7e-48 PFAM
Pfam:AF-4 159 350 2.6e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000039827
AA Change: W12R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044128
Gene: ENSMUSG00000037138
AA Change: W12R

DomainStartEndE-ValueType
Pfam:AF-4 20 170 4.9e-63 PFAM
Pfam:AF-4 160 1226 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095027
AA Change: W12R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092637
Gene: ENSMUSG00000037138
AA Change: W12R

DomainStartEndE-ValueType
Pfam:AF-4 20 172 1.7e-47 PFAM
Pfam:AF-4 161 1226 3.8e-268 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134963
Predicted Effect possibly damaging
Transcript: ENSMUST00000212668
AA Change: W12R

PolyPhen 2 Score 0.583 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tissue-restricted nuclear transcriptional activator that is preferentially expressed in lymphoid tissue. Isolation of this protein initially defined a highly conserved LAF4/MLLT2 gene family of nuclear transcription factors that may function in lymphoid development and oncogenesis. In some ALL patients, this gene has been found fused to the gene for MLL. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,678,326 D415E probably benign Het
Aldh3b2 G A 19: 3,981,034 G428S probably damaging Het
Arhgef10l A G 4: 140,536,845 L736P probably damaging Het
Baz2a G T 10: 128,113,666 E374* probably null Het
BC005561 G A 5: 104,522,154 S1514N probably benign Het
Casd1 T C 6: 4,635,888 probably null Het
Cct2 A T 10: 117,055,246 probably null Het
Cdc42bpg G A 19: 6,318,575 probably null Het
Copg2 T C 6: 30,863,613 probably null Het
Fbxw15 C T 9: 109,555,556 probably null Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Scap T A 9: 110,381,259 L912Q probably damaging Het
Sec61a2 T C 2: 5,876,548 D264G probably benign Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Sptbn2 T C 19: 4,718,983 I48T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tmprss13 T C 9: 45,332,467 F167S probably damaging Het
Ttc3 G A 16: 94,459,880 C1408Y probably benign Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vmn2r12 T A 5: 109,086,415 T644S possibly damaging Het
Vps13b A G 15: 35,794,361 S2306G probably benign Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Other mutations in Aff3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Aff3 APN 1 38535681 missense probably damaging 1.00
IGL02263:Aff3 APN 1 38535599 missense probably damaging 1.00
IGL02962:Aff3 APN 1 38535656 missense probably damaging 1.00
IGL03003:Aff3 APN 1 38209570 missense probably damaging 1.00
IGL03180:Aff3 APN 1 38535662 missense probably damaging 1.00
IGL03389:Aff3 APN 1 38210349 missense possibly damaging 0.62
PIT4377001:Aff3 UTSW 1 38538963 missense probably damaging 0.99
PIT4544001:Aff3 UTSW 1 38210362 missense probably benign 0.01
R0004:Aff3 UTSW 1 38269726 missense possibly damaging 0.46
R0004:Aff3 UTSW 1 38269726 missense possibly damaging 0.46
R0026:Aff3 UTSW 1 38203893 missense probably benign 0.00
R0279:Aff3 UTSW 1 38535569 missense probably damaging 1.00
R0344:Aff3 UTSW 1 38203932 missense probably benign
R0375:Aff3 UTSW 1 38204940 missense possibly damaging 0.46
R0605:Aff3 UTSW 1 38209987 missense probably damaging 1.00
R0613:Aff3 UTSW 1 38209923 missense probably benign 0.09
R1156:Aff3 UTSW 1 38204910 missense probably benign
R1255:Aff3 UTSW 1 38204884 splice site probably null
R1448:Aff3 UTSW 1 38191283 missense probably damaging 1.00
R1760:Aff3 UTSW 1 38329864 splice site probably benign
R1780:Aff3 UTSW 1 38535702 missense probably damaging 1.00
R1855:Aff3 UTSW 1 38210304 missense probably benign 0.23
R2011:Aff3 UTSW 1 38207915 missense probably benign 0.01
R2331:Aff3 UTSW 1 38204890 splice site probably null
R2965:Aff3 UTSW 1 38209710 missense probably damaging 1.00
R2970:Aff3 UTSW 1 38535022 missense probably damaging 0.97
R3015:Aff3 UTSW 1 38210568 missense probably benign 0.00
R3763:Aff3 UTSW 1 38252689 splice site probably benign
R4174:Aff3 UTSW 1 38207927 missense probably damaging 0.96
R4436:Aff3 UTSW 1 38209687 missense possibly damaging 0.75
R4661:Aff3 UTSW 1 38627128 missense possibly damaging 0.94
R5069:Aff3 UTSW 1 38181613 critical splice donor site probably null
R5566:Aff3 UTSW 1 38181424 missense probably damaging 1.00
R6023:Aff3 UTSW 1 38218370 missense probably damaging 1.00
R6209:Aff3 UTSW 1 38193589 missense probably benign 0.28
R6467:Aff3 UTSW 1 38208017 missense probably benign 0.25
R6748:Aff3 UTSW 1 38535246 missense probably damaging 1.00
R6862:Aff3 UTSW 1 38406497 missense possibly damaging 0.87
R6880:Aff3 UTSW 1 38535162 missense probably damaging 0.99
R6880:Aff3 UTSW 1 38627128 missense possibly damaging 0.94
R7187:Aff3 UTSW 1 38218397 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCGGAGACCGACGAATTCACG -3'
(R):5'- CGCCTCCCGGAGGAGAAAGA -3'

Sequencing Primer
(F):5'- CCGACGAATTCACGGGGAG -3'
(R):5'- ggctctcggcgagtgtg -3'
Posted On2013-09-30