Incidental Mutation 'R0742:Rpe'
ID70711
Institutional Source Beutler Lab
Gene Symbol Rpe
Ensembl Gene ENSMUSG00000026005
Gene Nameribulose-5-phosphate-3-epimerase
Synonyms
MMRRC Submission 038923-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0742 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location66700831-66719805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66715141 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 124 (T124I)
Ref Sequence ENSEMBL: ENSMUSP00000027157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027157] [ENSMUST00000068168] [ENSMUST00000113995] [ENSMUST00000142920] [ENSMUST00000151016] [ENSMUST00000190404]
Predicted Effect probably benign
Transcript: ENSMUST00000027157
AA Change: T124I

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027157
Gene: ENSMUSG00000026005
AA Change: T124I

DomainStartEndE-ValueType
Pfam:Ribul_P_3_epim 6 204 1.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068168
SMART Domains Protein: ENSMUSP00000063843
Gene: ENSMUSG00000026004

DomainStartEndE-ValueType
low complexity region 340 355 N/A INTRINSIC
low complexity region 491 507 N/A INTRINSIC
low complexity region 518 535 N/A INTRINSIC
PEHE 755 875 2.42e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113995
AA Change: T131I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109628
Gene: ENSMUSG00000026005
AA Change: T131I

DomainStartEndE-ValueType
Pfam:Ribul_P_3_epim 6 208 1.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129190
SMART Domains Protein: ENSMUSP00000118603
Gene: ENSMUSG00000026004

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 174 191 N/A INTRINSIC
PEHE 455 575 2.42e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142920
SMART Domains Protein: ENSMUSP00000137941
Gene: ENSMUSG00000026005

DomainStartEndE-ValueType
Pfam:Ribul_P_3_epim 6 49 3.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151016
Predicted Effect probably benign
Transcript: ENSMUST00000190404
SMART Domains Protein: ENSMUSP00000140257
Gene: ENSMUSG00000026005

DomainStartEndE-ValueType
Pfam:Ribul_P_3_epim 6 45 1.8e-4 PFAM
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,678,326 D415E probably benign Het
Aff3 A G 1: 38,627,108 W12R probably damaging Het
Aldh3b2 G A 19: 3,981,034 G428S probably damaging Het
Arhgef10l A G 4: 140,536,845 L736P probably damaging Het
Baz2a G T 10: 128,113,666 E374* probably null Het
BC005561 G A 5: 104,522,154 S1514N probably benign Het
Casd1 T C 6: 4,635,888 probably null Het
Cct2 A T 10: 117,055,246 probably null Het
Cdc42bpg G A 19: 6,318,575 probably null Het
Copg2 T C 6: 30,863,613 probably null Het
Fbxw15 C T 9: 109,555,556 probably null Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Scap T A 9: 110,381,259 L912Q probably damaging Het
Sec61a2 T C 2: 5,876,548 D264G probably benign Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Sptbn2 T C 19: 4,718,983 I48T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tmprss13 T C 9: 45,332,467 F167S probably damaging Het
Ttc3 G A 16: 94,459,880 C1408Y probably benign Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vmn2r12 T A 5: 109,086,415 T644S possibly damaging Het
Vps13b A G 15: 35,794,361 S2306G probably benign Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Other mutations in Rpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Rpe APN 1 66706515 missense probably benign
R0507:Rpe UTSW 1 66715141 missense probably benign 0.04
R1545:Rpe UTSW 1 66701010 missense probably damaging 1.00
R1808:Rpe UTSW 1 66715197 missense probably benign 0.26
R2118:Rpe UTSW 1 66715228 missense probably damaging 1.00
R2119:Rpe UTSW 1 66715228 missense probably damaging 1.00
R2120:Rpe UTSW 1 66715228 missense probably damaging 1.00
R2122:Rpe UTSW 1 66715228 missense probably damaging 1.00
R2126:Rpe UTSW 1 66715980 missense possibly damaging 0.95
R5549:Rpe UTSW 1 66716004 missense probably damaging 1.00
R5556:Rpe UTSW 1 66706466 missense probably damaging 1.00
R6238:Rpe UTSW 1 66701648 nonsense probably null
R6373:Rpe UTSW 1 66715980 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCTGGAAGGAGTTGAGGGCAT -3'
(R):5'- ACAGCTTTACGAAGACTGCAATGAAAAC -3'

Sequencing Primer
(F):5'- GGAGTTGAGGGCATGATCAAATATAT -3'
(R):5'- GCAGTATGTCTACTGAACAGACA -3'
Posted On2013-09-30