Incidental Mutation 'R0742:Casd1'
ID70722
Institutional Source Beutler Lab
Gene Symbol Casd1
Ensembl Gene ENSMUSG00000015189
Gene NameCAS1 domain containing 1
SynonymsCast1
MMRRC Submission 038923-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R0742 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location4600839-4643355 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 4635888 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000015333] [ENSMUST00000181734]
Predicted Effect probably null
Transcript: ENSMUST00000015333
SMART Domains Protein: ENSMUSP00000015333
Gene: ENSMUSG00000015189

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
Pfam:PC-Esterase 71 292 6.3e-33 PFAM
Pfam:Cas1_AcylT 295 776 9.4e-220 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000181734
SMART Domains Protein: ENSMUSP00000137822
Gene: ENSMUSG00000015189

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
Pfam:PC-Esterase 74 271 2.9e-18 PFAM
Pfam:Cas1_AcylT 272 402 3.4e-45 PFAM
Pfam:Cas1_AcylT 399 484 3.4e-37 PFAM
Pfam:Cas1_AcylT 480 527 4.4e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204372
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,678,326 D415E probably benign Het
Aff3 A G 1: 38,627,108 W12R probably damaging Het
Aldh3b2 G A 19: 3,981,034 G428S probably damaging Het
Arhgef10l A G 4: 140,536,845 L736P probably damaging Het
Baz2a G T 10: 128,113,666 E374* probably null Het
BC005561 G A 5: 104,522,154 S1514N probably benign Het
Cct2 A T 10: 117,055,246 probably null Het
Cdc42bpg G A 19: 6,318,575 probably null Het
Copg2 T C 6: 30,863,613 probably null Het
Fbxw15 C T 9: 109,555,556 probably null Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Scap T A 9: 110,381,259 L912Q probably damaging Het
Sec61a2 T C 2: 5,876,548 D264G probably benign Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Sptbn2 T C 19: 4,718,983 I48T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tmprss13 T C 9: 45,332,467 F167S probably damaging Het
Ttc3 G A 16: 94,459,880 C1408Y probably benign Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vmn2r12 T A 5: 109,086,415 T644S possibly damaging Het
Vps13b A G 15: 35,794,361 S2306G probably benign Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Other mutations in Casd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Casd1 APN 6 4607979 splice site probably benign
IGL00788:Casd1 APN 6 4624400 missense probably benign 0.30
IGL01161:Casd1 APN 6 4619833 missense possibly damaging 0.68
IGL01558:Casd1 APN 6 4624143 missense possibly damaging 0.56
IGL02124:Casd1 APN 6 4624142 missense probably benign 0.26
IGL02550:Casd1 APN 6 4642009 missense probably benign 0.03
IGL02822:Casd1 APN 6 4630017 missense probably damaging 1.00
IGL02957:Casd1 APN 6 4634068 missense possibly damaging 0.84
IGL03113:Casd1 APN 6 4640951 missense probably damaging 0.99
IGL03138:Casd1 UTSW 6 4613236 missense probably damaging 1.00
R0653:Casd1 UTSW 6 4608075 missense probably benign 0.00
R0673:Casd1 UTSW 6 4624440 missense possibly damaging 0.68
R0729:Casd1 UTSW 6 4619753 splice site probably benign
R0941:Casd1 UTSW 6 4635848 missense probably damaging 1.00
R1056:Casd1 UTSW 6 4641967 missense probably benign 0.03
R1390:Casd1 UTSW 6 4641859 missense probably benign 0.04
R1394:Casd1 UTSW 6 4624117 missense probably damaging 1.00
R1643:Casd1 UTSW 6 4621243 missense probably benign 0.06
R1653:Casd1 UTSW 6 4624134 missense probably benign 0.00
R1713:Casd1 UTSW 6 4624104 missense probably damaging 1.00
R1861:Casd1 UTSW 6 4640951 missense probably damaging 0.99
R1906:Casd1 UTSW 6 4641979 missense probably damaging 1.00
R2094:Casd1 UTSW 6 4608705 missense probably damaging 1.00
R3793:Casd1 UTSW 6 4619876 missense possibly damaging 0.90
R3896:Casd1 UTSW 6 4640980 missense probably damaging 1.00
R4519:Casd1 UTSW 6 4621102 missense probably benign 0.00
R4610:Casd1 UTSW 6 4631165 critical splice donor site probably null
R4673:Casd1 UTSW 6 4629975 missense probably damaging 0.97
R4819:Casd1 UTSW 6 4621225 missense probably damaging 0.99
R5920:Casd1 UTSW 6 4641853 missense probably null 1.00
R5929:Casd1 UTSW 6 4629993 missense probably damaging 1.00
R6130:Casd1 UTSW 6 4641948 missense probably damaging 1.00
R6181:Casd1 UTSW 6 4619331 missense probably damaging 1.00
R6291:Casd1 UTSW 6 4619834 missense probably damaging 0.96
R6305:Casd1 UTSW 6 4641892 missense probably damaging 1.00
R7147:Casd1 UTSW 6 4624187 missense probably benign 0.07
R7150:Casd1 UTSW 6 4624211 missense probably benign 0.01
X0021:Casd1 UTSW 6 4641935 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCACTCGCTTGATTAGACAGTCAAA -3'
(R):5'- TGGCTTTTCACATTCACGAGCACAT -3'

Sequencing Primer
(F):5'- AAGTCTTAAGCTTCTAGCCCAGG -3'
(R):5'- atccgcctgtctctgcc -3'
Posted On2013-09-30