Incidental Mutation 'R0742:Copg2'
ID70723
Institutional Source Beutler Lab
Gene Symbol Copg2
Ensembl Gene ENSMUSG00000025607
Gene Namecoatomer protein complex, subunit gamma 2
Synonyms
MMRRC Submission 038923-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.882) question?
Stock #R0742 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location30747554-30896794 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 30863613 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048774] [ENSMUST00000166192]
Predicted Effect probably null
Transcript: ENSMUST00000048774
SMART Domains Protein: ENSMUSP00000038368
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 2.6e-134 PFAM
Pfam:COP-gamma_platf 609 756 7.7e-66 PFAM
Pfam:Coatomer_g_Cpla 758 870 1.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135230
SMART Domains Protein: ENSMUSP00000119995
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 246 1.3e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166192
SMART Domains Protein: ENSMUSP00000126726
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 380 6.5e-92 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,678,326 D415E probably benign Het
Aff3 A G 1: 38,627,108 W12R probably damaging Het
Aldh3b2 G A 19: 3,981,034 G428S probably damaging Het
Arhgef10l A G 4: 140,536,845 L736P probably damaging Het
Baz2a G T 10: 128,113,666 E374* probably null Het
BC005561 G A 5: 104,522,154 S1514N probably benign Het
Casd1 T C 6: 4,635,888 probably null Het
Cct2 A T 10: 117,055,246 probably null Het
Cdc42bpg G A 19: 6,318,575 probably null Het
Fbxw15 C T 9: 109,555,556 probably null Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Scap T A 9: 110,381,259 L912Q probably damaging Het
Sec61a2 T C 2: 5,876,548 D264G probably benign Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Sptbn2 T C 19: 4,718,983 I48T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tmprss13 T C 9: 45,332,467 F167S probably damaging Het
Ttc3 G A 16: 94,459,880 C1408Y probably benign Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vmn2r12 T A 5: 109,086,415 T644S possibly damaging Het
Vps13b A G 15: 35,794,361 S2306G probably benign Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Other mutations in Copg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02324:Copg2 APN 6 30863534 critical splice donor site probably null
IGL02511:Copg2 APN 6 30858822 missense probably benign 0.00
R0612:Copg2 UTSW 6 30861469 splice site probably null
R0723:Copg2 UTSW 6 30815982 missense possibly damaging 0.94
R1708:Copg2 UTSW 6 30824377 missense probably damaging 1.00
R1775:Copg2 UTSW 6 30810336 missense probably damaging 1.00
R1826:Copg2 UTSW 6 30812842 missense probably benign 0.00
R2011:Copg2 UTSW 6 30816741 critical splice donor site probably null
R2170:Copg2 UTSW 6 30812822 frame shift probably null
R2358:Copg2 UTSW 6 30826233 nonsense probably null
R2393:Copg2 UTSW 6 30810958 missense probably benign 0.00
R2512:Copg2 UTSW 6 30896656 splice site probably null
R4595:Copg2 UTSW 6 30749450 missense probably damaging 0.98
R4613:Copg2 UTSW 6 30811596 missense probably benign
R5243:Copg2 UTSW 6 30750627 missense probably benign 0.01
R5293:Copg2 UTSW 6 30826227 missense probably damaging 0.98
R6019:Copg2 UTSW 6 30810933 missense possibly damaging 0.54
R6235:Copg2 UTSW 6 30816071 missense probably damaging 1.00
R6605:Copg2 UTSW 6 30858822 missense probably benign 0.31
R6857:Copg2 UTSW 6 30863598 missense possibly damaging 0.94
R7132:Copg2 UTSW 6 30815996 missense probably benign 0.00
R7216:Copg2 UTSW 6 30885600 missense probably damaging 0.99
R7223:Copg2 UTSW 6 30812754 nonsense probably null
R7288:Copg2 UTSW 6 30824406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTTGAGAAGATTGAGACCTCAGAA -3'
(R):5'- TCACCACCACTATCGCCATCACTATT -3'

Sequencing Primer
(F):5'- GAAGATTGAGACCTCAGAAATACAC -3'
(R):5'- AAACTTGGTTATGTTCACCACTC -3'
Posted On2013-09-30