Incidental Mutation 'R0742:Fbxw15'
ID70728
Institutional Source Beutler Lab
Gene Symbol Fbxw15
Ensembl Gene ENSMUSG00000074060
Gene NameF-box and WD-40 domain protein 15
SynonymsFbxo12J
MMRRC Submission 038923-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0742 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109552602-109568262 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 109555556 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056745] [ENSMUST00000198112] [ENSMUST00000198397]
Predicted Effect probably null
Transcript: ENSMUST00000056745
SMART Domains Protein: ENSMUSP00000058175
Gene: ENSMUSG00000074060

DomainStartEndE-ValueType
FBOX 8 45 3.25e-4 SMART
SCOP:d1flga_ 73 413 3e-7 SMART
Blast:WD40 137 176 5e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196601
Predicted Effect probably benign
Transcript: ENSMUST00000198112
SMART Domains Protein: ENSMUSP00000142894
Gene: ENSMUSG00000074060

DomainStartEndE-ValueType
FBOX 8 45 2.1e-6 SMART
SCOP:d1tbga_ 73 196 3e-5 SMART
Blast:WD40 84 123 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198397
SMART Domains Protein: ENSMUSP00000143385
Gene: ENSMUSG00000074060

DomainStartEndE-ValueType
FBOX 8 45 3.25e-4 SMART
SCOP:d1tbga_ 116 240 1e-3 SMART
Blast:WD40 137 176 6e-6 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,678,326 D415E probably benign Het
Aff3 A G 1: 38,627,108 W12R probably damaging Het
Aldh3b2 G A 19: 3,981,034 G428S probably damaging Het
Arhgef10l A G 4: 140,536,845 L736P probably damaging Het
Baz2a G T 10: 128,113,666 E374* probably null Het
BC005561 G A 5: 104,522,154 S1514N probably benign Het
Casd1 T C 6: 4,635,888 probably null Het
Cct2 A T 10: 117,055,246 probably null Het
Cdc42bpg G A 19: 6,318,575 probably null Het
Copg2 T C 6: 30,863,613 probably null Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Scap T A 9: 110,381,259 L912Q probably damaging Het
Sec61a2 T C 2: 5,876,548 D264G probably benign Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Sptbn2 T C 19: 4,718,983 I48T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tmprss13 T C 9: 45,332,467 F167S probably damaging Het
Ttc3 G A 16: 94,459,880 C1408Y probably benign Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vmn2r12 T A 5: 109,086,415 T644S possibly damaging Het
Vps13b A G 15: 35,794,361 S2306G probably benign Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Other mutations in Fbxw15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02094:Fbxw15 APN 9 109558240 missense possibly damaging 0.87
IGL02239:Fbxw15 APN 9 109559837 missense probably benign 0.01
IGL02343:Fbxw15 APN 9 109552655 utr 3 prime probably benign
IGL02748:Fbxw15 APN 9 109558210 missense possibly damaging 0.66
IGL03206:Fbxw15 APN 9 109565362 missense possibly damaging 0.90
IGL03370:Fbxw15 APN 9 109555151 missense probably benign 0.00
lagging UTSW 9 109555673 unclassified probably null
R0321:Fbxw15 UTSW 9 109565385 missense probably benign 0.03
R1141:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1143:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1276:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1282:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1283:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1321:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1324:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1341:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1716:Fbxw15 UTSW 9 109557136 missense probably benign 0.00
R1750:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1757:Fbxw15 UTSW 9 109557279 missense probably damaging 0.99
R1765:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1799:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1826:Fbxw15 UTSW 9 109559714 splice site probably null
R1897:Fbxw15 UTSW 9 109558203 nonsense probably null
R2237:Fbxw15 UTSW 9 109555235 missense probably damaging 0.99
R2346:Fbxw15 UTSW 9 109565432 missense probably damaging 1.00
R4391:Fbxw15 UTSW 9 109568232 start gained probably benign
R4392:Fbxw15 UTSW 9 109568232 start gained probably benign
R4812:Fbxw15 UTSW 9 109559922 missense probably benign 0.01
R5198:Fbxw15 UTSW 9 109558174 missense probably benign 0.00
R5278:Fbxw15 UTSW 9 109555684 missense probably benign 0.03
R5541:Fbxw15 UTSW 9 109565430 missense probably benign 0.23
R5899:Fbxw15 UTSW 9 109555673 unclassified probably null
R5975:Fbxw15 UTSW 9 109555252 missense probably damaging 1.00
R6065:Fbxw15 UTSW 9 109568178 missense probably damaging 1.00
R6285:Fbxw15 UTSW 9 109557166 missense probably benign 0.09
R7357:Fbxw15 UTSW 9 109558240 missense probably benign 0.28
X0026:Fbxw15 UTSW 9 109558187 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACCCAAGTGTTAGTAGGCTGGAG -3'
(R):5'- AATGTCACAAGGTGAACCCACAGAG -3'

Sequencing Primer
(F):5'- ggctcatcaggtaaaggcac -3'
(R):5'- ACCCACAGAGGTTTGGAGTC -3'
Posted On2013-09-30