Incidental Mutation 'R0742:Cct2'
ID70733
Institutional Source Beutler Lab
Gene Symbol Cct2
Ensembl Gene ENSMUSG00000034024
Gene Namechaperonin containing Tcp1, subunit 2 (beta)
SynonymsCctb
MMRRC Submission 038923-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R0742 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location117051001-117063814 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 117055246 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047672]
Predicted Effect probably null
Transcript: ENSMUST00000047672
SMART Domains Protein: ENSMUSP00000036288
Gene: ENSMUSG00000034024

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 35 525 3.2e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218502
Predicted Effect probably benign
Transcript: ENSMUST00000219690
Meta Mutation Damage Score 0.64 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,678,326 D415E probably benign Het
Aff3 A G 1: 38,627,108 W12R probably damaging Het
Aldh3b2 G A 19: 3,981,034 G428S probably damaging Het
Arhgef10l A G 4: 140,536,845 L736P probably damaging Het
Baz2a G T 10: 128,113,666 E374* probably null Het
BC005561 G A 5: 104,522,154 S1514N probably benign Het
Casd1 T C 6: 4,635,888 probably null Het
Cdc42bpg G A 19: 6,318,575 probably null Het
Copg2 T C 6: 30,863,613 probably null Het
Fbxw15 C T 9: 109,555,556 probably null Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Scap T A 9: 110,381,259 L912Q probably damaging Het
Sec61a2 T C 2: 5,876,548 D264G probably benign Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Sptbn2 T C 19: 4,718,983 I48T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tmprss13 T C 9: 45,332,467 F167S probably damaging Het
Ttc3 G A 16: 94,459,880 C1408Y probably benign Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vmn2r12 T A 5: 109,086,415 T644S possibly damaging Het
Vps13b A G 15: 35,794,361 S2306G probably benign Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Other mutations in Cct2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Cct2 APN 10 117053112 missense probably damaging 0.99
IGL02150:Cct2 APN 10 117062099 missense probably damaging 0.99
IGL02349:Cct2 APN 10 117053139 missense probably benign 0.04
IGL03010:Cct2 APN 10 117058114 missense probably damaging 1.00
IGL03155:Cct2 APN 10 117060671 missense probably damaging 0.99
R0507:Cct2 UTSW 10 117055246 splice site probably null
R1102:Cct2 UTSW 10 117060640 unclassified probably null
R1438:Cct2 UTSW 10 117054992 unclassified probably benign
R2040:Cct2 UTSW 10 117053113 missense probably benign 0.00
R2157:Cct2 UTSW 10 117062809 splice site probably benign
R2227:Cct2 UTSW 10 117053017 missense probably null 0.18
R3410:Cct2 UTSW 10 117062063 missense probably benign 0.01
R3981:Cct2 UTSW 10 117054135 missense probably damaging 1.00
R3983:Cct2 UTSW 10 117054135 missense probably damaging 1.00
R4364:Cct2 UTSW 10 117055151 missense probably damaging 1.00
R4401:Cct2 UTSW 10 117057809 missense possibly damaging 0.61
R6162:Cct2 UTSW 10 117058186 missense probably damaging 0.99
R6300:Cct2 UTSW 10 117056159 missense probably damaging 0.96
R6312:Cct2 UTSW 10 117056055 missense probably benign 0.00
R7075:Cct2 UTSW 10 117061465 missense unknown
R7198:Cct2 UTSW 10 117053124 missense probably benign
R7236:Cct2 UTSW 10 117061559 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCGTCTCTGTTTCTATAAAAGCCAA -3'
(R):5'- AAAGTCAGGTTGATACTTGCTGCCTT -3'

Sequencing Primer
(F):5'- TCTAAGTCGGACCTACTGTCAAG -3'
(R):5'- GATACTTGCTGCCTTTTGAAATG -3'
Posted On2013-09-30