Incidental Mutation 'R0742:Fyb'
ID70739
Institutional Source Beutler Lab
Gene Symbol Fyb
Ensembl Gene ENSMUSG00000022148
Gene NameFYN binding protein
SynonymsB630013F22Rik, ADAP, FYB-120/130
MMRRC Submission 038923-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0742 (G1)
Quality Score177
Status Not validated
Chromosome15
Chromosomal Location6522853-6663313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6634816 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 460 (D460G)
Ref Sequence ENSEMBL: ENSMUSP00000087947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090461] [ENSMUST00000160612]
Predicted Effect probably benign
Transcript: ENSMUST00000090461
AA Change: D460G

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000087947
Gene: ENSMUSG00000022148
AA Change: D460G

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
low complexity region 236 246 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
low complexity region 371 409 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 457 494 N/A INTRINSIC
SH3 502 559 1.24e-3 SMART
low complexity region 611 626 N/A INTRINSIC
Pfam:hSH3 731 819 2.9e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160612
SMART Domains Protein: ENSMUSP00000124553
Gene: ENSMUSG00000022148

DomainStartEndE-ValueType
low complexity region 27 65 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162430
Meta Mutation Damage Score 0.1864 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is an adapter molecule that affects T cell receptor signaling and contains multiple protein-protein interaction domains. It is thought to couple T cell receptor stimulation with activation of integrin function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased T cell proliferation, thymocytes and platelet counts and decreased TCR-stimulated leukocyte adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,678,326 D415E probably benign Het
Aff3 A G 1: 38,627,108 W12R probably damaging Het
Aldh3b2 G A 19: 3,981,034 G428S probably damaging Het
Arhgef10l A G 4: 140,536,845 L736P probably damaging Het
Baz2a G T 10: 128,113,666 E374* probably null Het
BC005561 G A 5: 104,522,154 S1514N probably benign Het
Casd1 T C 6: 4,635,888 probably null Het
Cct2 A T 10: 117,055,246 probably null Het
Cdc42bpg G A 19: 6,318,575 probably null Het
Copg2 T C 6: 30,863,613 probably null Het
Fbxw15 C T 9: 109,555,556 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Scap T A 9: 110,381,259 L912Q probably damaging Het
Sec61a2 T C 2: 5,876,548 D264G probably benign Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Sptbn2 T C 19: 4,718,983 I48T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tmprss13 T C 9: 45,332,467 F167S probably damaging Het
Ttc3 G A 16: 94,459,880 C1408Y probably benign Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vmn2r12 T A 5: 109,086,415 T644S possibly damaging Het
Vps13b A G 15: 35,794,361 S2306G probably benign Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Other mutations in Fyb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fyb APN 15 6580777 missense probably damaging 0.99
IGL00801:Fyb APN 15 6644824 missense possibly damaging 0.86
IGL00974:Fyb APN 15 6642585 unclassified probably benign
IGL01377:Fyb APN 15 6580320 missense probably benign 0.01
IGL01982:Fyb APN 15 6580177 missense probably null 0.99
IGL02173:Fyb APN 15 6580695 missense probably benign 0.00
IGL02177:Fyb APN 15 6658566 critical splice donor site probably null
IGL02345:Fyb APN 15 6619662 missense possibly damaging 0.94
IGL02695:Fyb APN 15 6580921 missense probably damaging 1.00
IGL02820:Fyb APN 15 6658559 missense possibly damaging 0.65
IGL02867:Fyb APN 15 6580046 missense probably damaging 1.00
luegner UTSW 15 6580869 nonsense probably null
uebeltaeter UTSW 15 6638907 missense probably damaging 1.00
P0023:Fyb UTSW 15 6651854 missense probably damaging 1.00
R0028:Fyb UTSW 15 6644914 intron probably benign
R0364:Fyb UTSW 15 6580791 missense probably damaging 1.00
R0507:Fyb UTSW 15 6634816 missense probably benign 0.39
R0588:Fyb UTSW 15 6580459 missense probably benign 0.03
R0930:Fyb UTSW 15 6638828 missense probably damaging 1.00
R1184:Fyb UTSW 15 6638900 missense probably damaging 1.00
R1446:Fyb UTSW 15 6652466 missense probably benign 0.02
R1481:Fyb UTSW 15 6619647 missense probably benign 0.01
R1711:Fyb UTSW 15 6580479 missense probably damaging 1.00
R2041:Fyb UTSW 15 6644787 missense possibly damaging 0.78
R2176:Fyb UTSW 15 6579954 missense probably damaging 1.00
R2224:Fyb UTSW 15 6652383 missense probably damaging 1.00
R2372:Fyb UTSW 15 6651907 splice site probably benign
R3236:Fyb UTSW 15 6630116 missense probably damaging 0.96
R4117:Fyb UTSW 15 6630116 missense probably damaging 0.96
R4181:Fyb UTSW 15 6580923 missense probably benign 0.00
R4322:Fyb UTSW 15 6580819 missense possibly damaging 0.84
R4952:Fyb UTSW 15 6638811 missense probably damaging 1.00
R4981:Fyb UTSW 15 6646611 splice site probably benign
R5055:Fyb UTSW 15 6585149 unclassified probably benign
R5368:Fyb UTSW 15 6580678 unclassified probably null
R5719:Fyb UTSW 15 6580869 nonsense probably null
R5822:Fyb UTSW 15 6663226 unclassified probably benign
R6064:Fyb UTSW 15 6638868 missense probably damaging 1.00
R6929:Fyb UTSW 15 6638907 missense probably damaging 1.00
R7125:Fyb UTSW 15 6644856 missense possibly damaging 0.77
R7243:Fyb UTSW 15 6643699 missense probably benign 0.19
Z1088:Fyb UTSW 15 6658540 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ATGGGCTCCTCTGGCTTTACAAAC -3'
(R):5'- ACTCTGTGATGTGCCATTGGGAC -3'

Sequencing Primer
(F):5'- TCTGGCTTTACAAACAATCTCAC -3'
(R):5'- CTCATGGCACACAGTAATGATG -3'
Posted On2013-09-30