Incidental Mutation 'R0742:Twf1'
ID70743
Institutional Source Beutler Lab
Gene Symbol Twf1
Ensembl Gene ENSMUSG00000022451
Gene Nametwinfilin actin binding protein 1
Synonymsactin monomer-binding protein, A6, Twinfilin-1, Ptk9, twinfilin
MMRRC Submission 038923-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0742 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location94577951-94589889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94585530 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 99 (M99T)
Ref Sequence ENSEMBL: ENSMUSP00000023087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023087] [ENSMUST00000109248] [ENSMUST00000152590]
PDB Structure
CRYSTAL STRUCTURE OF THE N-TERMINAL ADF-H DOMAIN OF MOUSE TWINFILIN ISOFORM-1 [X-RAY DIFFRACTION]
Solution structure of the second tandem cofilin-domain of mouse twinfilin [SOLUTION NMR]
Solution structure of C-teminal domain of twinfilin-1. [SOLUTION NMR]
Structure of the actin-depolymerizing factor homology domain in complex with actin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000023087
AA Change: M99T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023087
Gene: ENSMUSG00000022451
AA Change: M99T

DomainStartEndE-ValueType
ADF 11 139 4.74e-35 SMART
ADF 184 313 6.22e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109248
SMART Domains Protein: ENSMUSP00000104871
Gene: ENSMUSG00000059883

DomainStartEndE-ValueType
Pfam:Death 20 101 1.6e-6 PFAM
Pfam:Pkinase_Tyr 187 452 1.9e-51 PFAM
Pfam:Pkinase 188 452 1.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127347
Predicted Effect probably damaging
Transcript: ENSMUST00000152590
AA Change: M73T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119302
Gene: ENSMUSG00000022451
AA Change: M73T

DomainStartEndE-ValueType
ADF 1 113 1.9e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155654
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes twinfilin, an actin monomer-binding protein conserved from yeast to mammals. Studies of the mouse counterpart suggest that this protein may be an actin monomer-binding protein, and its localization to cortical G-actin-rich structures may be regulated by the small GTPase RAC1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,678,326 D415E probably benign Het
Aff3 A G 1: 38,627,108 W12R probably damaging Het
Aldh3b2 G A 19: 3,981,034 G428S probably damaging Het
Arhgef10l A G 4: 140,536,845 L736P probably damaging Het
Baz2a G T 10: 128,113,666 E374* probably null Het
BC005561 G A 5: 104,522,154 S1514N probably benign Het
Casd1 T C 6: 4,635,888 probably null Het
Cct2 A T 10: 117,055,246 probably null Het
Cdc42bpg G A 19: 6,318,575 probably null Het
Copg2 T C 6: 30,863,613 probably null Het
Fbxw15 C T 9: 109,555,556 probably null Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Scap T A 9: 110,381,259 L912Q probably damaging Het
Sec61a2 T C 2: 5,876,548 D264G probably benign Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Sptbn2 T C 19: 4,718,983 I48T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tmprss13 T C 9: 45,332,467 F167S probably damaging Het
Ttc3 G A 16: 94,459,880 C1408Y probably benign Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vmn2r12 T A 5: 109,086,415 T644S possibly damaging Het
Vps13b A G 15: 35,794,361 S2306G probably benign Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Other mutations in Twf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Twf1 APN 15 94580936 unclassified probably benign
IGL02732:Twf1 APN 15 94581009 missense probably damaging 1.00
R0122:Twf1 UTSW 15 94586549 splice site probably benign
R0184:Twf1 UTSW 15 94581067 critical splice acceptor site probably null
R0507:Twf1 UTSW 15 94585530 missense probably damaging 1.00
R1200:Twf1 UTSW 15 94586358 missense probably benign 0.05
R1858:Twf1 UTSW 15 94585547 splice site probably benign
R2005:Twf1 UTSW 15 94585447 critical splice donor site probably null
R2290:Twf1 UTSW 15 94586519 missense probably damaging 0.98
R3732:Twf1 UTSW 15 94584414 unclassified probably benign
R4787:Twf1 UTSW 15 94584434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTTATAGACCGGGACACTGAAAC -3'
(R):5'- CACGGCAAAGGCTGCTTTGTATTG -3'

Sequencing Primer
(F):5'- cctccctccctccctcc -3'
(R):5'- AAAGGCTGCTTTGTATTGATCCC -3'
Posted On2013-09-30