Incidental Mutation 'R0742:Aldh3b2'
ID70745
Institutional Source Beutler Lab
Gene Symbol Aldh3b2
Ensembl Gene ENSMUSG00000075296
Gene Namealdehyde dehydrogenase 3 family, member B2
Synonyms
MMRRC Submission 038923-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0742 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location3972328-3981645 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3981034 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 428 (G428S)
Ref Sequence ENSEMBL: ENSMUSP00000115356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143380]
Predicted Effect probably damaging
Transcript: ENSMUST00000143380
AA Change: G428S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115356
Gene: ENSMUSG00000075296
AA Change: G428S

DomainStartEndE-ValueType
Pfam:Aldedh 6 441 1.2e-87 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,678,326 D415E probably benign Het
Aff3 A G 1: 38,627,108 W12R probably damaging Het
Arhgef10l A G 4: 140,536,845 L736P probably damaging Het
Baz2a G T 10: 128,113,666 E374* probably null Het
BC005561 G A 5: 104,522,154 S1514N probably benign Het
Casd1 T C 6: 4,635,888 probably null Het
Cct2 A T 10: 117,055,246 probably null Het
Cdc42bpg G A 19: 6,318,575 probably null Het
Copg2 T C 6: 30,863,613 probably null Het
Fbxw15 C T 9: 109,555,556 probably null Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Scap T A 9: 110,381,259 L912Q probably damaging Het
Sec61a2 T C 2: 5,876,548 D264G probably benign Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Sptbn2 T C 19: 4,718,983 I48T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tmprss13 T C 9: 45,332,467 F167S probably damaging Het
Ttc3 G A 16: 94,459,880 C1408Y probably benign Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vmn2r12 T A 5: 109,086,415 T644S possibly damaging Het
Vps13b A G 15: 35,794,361 S2306G probably benign Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Other mutations in Aldh3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02888:Aldh3b2 APN 19 3980083 missense probably benign 0.32
R0242:Aldh3b2 UTSW 19 3979414 nonsense probably null
R0242:Aldh3b2 UTSW 19 3979414 nonsense probably null
R0924:Aldh3b2 UTSW 19 3979350 missense probably benign 0.09
R1531:Aldh3b2 UTSW 19 3977543 missense probably damaging 1.00
R1748:Aldh3b2 UTSW 19 3977572 missense probably damaging 0.99
R1899:Aldh3b2 UTSW 19 3978662 missense possibly damaging 0.55
R1968:Aldh3b2 UTSW 19 3980705 missense probably benign 0.22
R2228:Aldh3b2 UTSW 19 3981133 missense probably benign 0.00
R4282:Aldh3b2 UTSW 19 3977636 missense probably benign 0.03
R4403:Aldh3b2 UTSW 19 3980059 missense probably damaging 1.00
R4717:Aldh3b2 UTSW 19 3981128 missense probably damaging 1.00
R4865:Aldh3b2 UTSW 19 3978469 missense probably damaging 1.00
R5093:Aldh3b2 UTSW 19 3979433 missense probably benign 0.00
R7035:Aldh3b2 UTSW 19 3978142 missense probably benign 0.23
R7223:Aldh3b2 UTSW 19 3979592 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGTGAATCAGATGTTGGAACGCAC -3'
(R):5'- ACTTGGAAGCCGCTGAAAGCTC -3'

Sequencing Primer
(F):5'- AGGCAACGATGGCTTCCTC -3'
(R):5'- CCGCTGAAAGCTCAGGTAG -3'
Posted On2013-09-30