Incidental Mutation 'R0744:Ccnt2'
ID70814
Institutional Source Beutler Lab
Gene Symbol Ccnt2
Ensembl Gene ENSMUSG00000026349
Gene Namecyclin T2
Synonyms2900041I18Rik, CycT2
MMRRC Submission 038925-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0744 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location127774164-127808061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127802394 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 336 (M336K)
Ref Sequence ENSEMBL: ENSMUSP00000108189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027587] [ENSMUST00000112570]
Predicted Effect probably benign
Transcript: ENSMUST00000027587
AA Change: M336K

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027587
Gene: ENSMUSG00000026349
AA Change: M336K

DomainStartEndE-ValueType
CYCLIN 42 141 4.27e-14 SMART
CYCLIN 154 242 4.51e0 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 621 653 N/A INTRINSIC
low complexity region 658 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112570
AA Change: M336K

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108189
Gene: ENSMUSG00000026349
AA Change: M336K

DomainStartEndE-ValueType
CYCLIN 42 141 4.27e-14 SMART
CYCLIN 154 242 4.51e0 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153359
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin and its kinase partner CDK9 were found to be subunits of the transcription elongation factor p-TEFb. The p-TEFb complex containing this cyclin was reported to interact with, and act as a negative regulator of human immunodeficiency virus type 1 (HIV-1) Tat protein. A pseudogene of this gene is found on chromosome 1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to the 4-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,165,069 L41P probably damaging Het
A930003A15Rik T C 16: 19,883,872 noncoding transcript Het
Abca8a A T 11: 110,040,564 D1253E possibly damaging Het
Acsm3 T C 7: 119,777,100 I350T possibly damaging Het
Adcy9 T C 16: 4,419,271 D92G possibly damaging Het
Aebp2 T G 6: 140,642,364 probably null Het
AI987944 T C 7: 41,376,859 Y6C probably damaging Het
Ascc3 T C 10: 50,845,666 W2072R probably benign Het
Asxl3 A G 18: 22,516,040 D362G probably damaging Het
Baiap2l1 T A 5: 144,266,641 D479V probably benign Het
Bdp1 A T 13: 100,035,825 H2094Q probably benign Het
Bptf C A 11: 107,110,812 probably null Het
Camk4 G T 18: 32,939,454 S20I unknown Het
Ccdc36 A T 9: 108,404,801 C563S probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Cd209e G T 8: 3,853,205 D62E probably benign Het
Cd226 A C 18: 89,207,020 probably benign Het
Clip1 T C 5: 123,630,721 D605G probably benign Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
Dmxl1 T C 18: 49,833,148 V20A probably damaging Het
Dzip3 A G 16: 48,959,675 Y301H probably damaging Het
Ephb4 T A 5: 137,365,667 N600K probably damaging Het
Erich6 T A 3: 58,636,122 probably benign Het
Fbn1 T C 2: 125,314,814 probably benign Het
Fryl A T 5: 73,089,081 probably benign Het
Galnt17 T A 5: 131,150,916 D131V probably damaging Het
Gm13089 A T 4: 143,698,486 M129K probably benign Het
Gm597 A G 1: 28,777,821 S377P possibly damaging Het
Gm6619 T A 6: 131,490,334 L54Q probably damaging Het
Herc2 T C 7: 56,206,036 probably benign Het
Hic1 T A 11: 75,165,801 Q754L possibly damaging Het
Hnf4g A T 3: 3,651,629 D286V possibly damaging Het
Itgb5 A G 16: 33,900,583 K339R probably damaging Het
Itih1 A T 14: 30,941,555 V164E probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Lamp1 T A 8: 13,172,654 F279L probably damaging Het
Lrfn5 A C 12: 61,839,668 T81P probably damaging Het
Lrrc58 A G 16: 37,878,573 probably benign Het
March6 T C 15: 31,480,291 Y562C probably benign Het
Mark1 T A 1: 184,921,608 I166F probably damaging Het
Mark2 A G 19: 7,285,824 Y193H probably damaging Het
Mast4 C G 13: 102,737,387 Q1632H probably damaging Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Mgst3 A G 1: 167,373,805 Y104H probably damaging Het
Mlxipl C T 5: 135,132,475 T416I possibly damaging Het
Mthfd2l T C 5: 90,946,942 V90A probably damaging Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Muc1 C A 3: 89,230,328 P159Q possibly damaging Het
Myom2 A T 8: 15,132,924 K1454* probably null Het
Myt1 TGAGGAGGAGGAGGAGGAGG TGAGGAGGAGGAGGAGG 2: 181,797,505 probably benign Het
Olfr1513 T C 14: 52,349,378 I223V probably benign Het
Olfr329-ps T A 11: 58,543,162 M105L possibly damaging Het
Olfr504 T C 7: 108,564,998 T266A possibly damaging Het
Olfr629 T C 7: 103,740,925 H105R probably damaging Het
Olfr905 A T 9: 38,472,785 I13F probably benign Het
Pdcd6 A G 13: 74,316,324 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Pzp A G 6: 128,516,195 probably benign Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapgef3 G A 15: 97,761,585 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rgs11 T A 17: 26,203,318 M29K probably damaging Het
Rictor A G 15: 6,764,278 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rims1 T C 1: 22,427,459 probably null Het
Samd9l T C 6: 3,372,725 E1512G possibly damaging Het
Sgsm1 C T 5: 113,279,184 A127T probably benign Het
Slc22a28 T C 19: 8,116,833 Y245C possibly damaging Het
Slc25a1 T A 16: 17,927,436 H78L probably benign Het
Slc26a1 T A 5: 108,673,523 T167S probably benign Het
Slc2a12 T C 10: 22,702,016 probably benign Het
Slc44a5 T C 3: 154,265,474 S654P probably damaging Het
Slc51a T A 16: 32,475,849 T306S probably benign Het
Slc6a13 T G 6: 121,302,867 W67G probably damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Sp100 A T 1: 85,699,744 I86L probably damaging Het
Supt20 T A 3: 54,714,701 Y409N probably damaging Het
Synrg C T 11: 84,024,305 Q1046* probably null Het
Tab2 T C 10: 7,907,581 probably benign Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tex24 A T 8: 27,344,720 H92L possibly damaging Het
Tgm6 T C 2: 130,151,761 V640A probably benign Het
Tle2 T C 10: 81,588,947 F667L probably damaging Het
Tnfaip3 C A 10: 19,002,949 A704S probably benign Het
Tomm34 T C 2: 164,070,976 N22D probably benign Het
Trabd2b A G 4: 114,580,322 Q232R probably benign Het
Trim62 A G 4: 128,884,215 S16G probably damaging Het
Ttc28 T A 5: 111,231,081 I1144N probably damaging Het
Unc5a C A 13: 55,003,933 N56K possibly damaging Het
Ush2a C T 1: 188,814,406 probably benign Het
Wrn A G 8: 33,295,006 I446T possibly damaging Het
Zbed5 T A 5: 129,902,272 V354E possibly damaging Het
Zfp266 G A 9: 20,499,799 H361Y probably damaging Het
Other mutations in Ccnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ccnt2 APN 1 127797891 splice site probably benign
IGL01370:Ccnt2 APN 1 127803513 missense possibly damaging 0.49
IGL02055:Ccnt2 APN 1 127791710 missense possibly damaging 0.46
IGL02169:Ccnt2 APN 1 127774389 splice site probably benign
R0526:Ccnt2 UTSW 1 127799445 missense probably damaging 1.00
R0538:Ccnt2 UTSW 1 127803165 missense probably damaging 0.98
R0833:Ccnt2 UTSW 1 127802394 missense probably benign 0.42
R0836:Ccnt2 UTSW 1 127802394 missense probably benign 0.42
R1763:Ccnt2 UTSW 1 127799406 missense possibly damaging 0.94
R2037:Ccnt2 UTSW 1 127803399 missense probably damaging 1.00
R2159:Ccnt2 UTSW 1 127775154 missense probably benign 0.00
R4585:Ccnt2 UTSW 1 127803029 missense probably damaging 0.99
R5342:Ccnt2 UTSW 1 127791733 splice site silent
R5527:Ccnt2 UTSW 1 127802664 missense probably benign 0.00
R5698:Ccnt2 UTSW 1 127803228 missense probably benign 0.00
R6606:Ccnt2 UTSW 1 127803241 missense probably benign 0.00
R6821:Ccnt2 UTSW 1 127803335 missense probably damaging 0.99
R6979:Ccnt2 UTSW 1 127775136 missense probably damaging 0.97
X0019:Ccnt2 UTSW 1 127775140 missense probably damaging 1.00
X0027:Ccnt2 UTSW 1 127774288 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGAGACACCACTGCTTGGTTCATC -3'
(R):5'- AAGGGTTTCCAGCTTCCGCTTC -3'

Sequencing Primer
(F):5'- CACTGCTTGGTTCATCTTTGG -3'
(R):5'- GAATGATCAGCAACTTTGTCCG -3'
Posted On2013-09-30